Prupe.6G105300_v2.0.a1

Ribonuclease H protein

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp06
Physical Location & Seq
Reverse (-)
7463274 .. 7463737
464 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.6G105300.1

Sequence Viewer

Length: 414 bp
ATGGGGCTCAAGTTGGATATGAATAAGGCCTATGACAGAATTGAGTGGGATTTTGTGAAAGAAGTGTCGCTAAAATTGGGGTTTGATCGAACTTGGGTGCGCCAGGTTATGGGGTGGATCATCTCAATCCGGTTCATAATGCTCTTAAATGGTAAATCTGGGAGTTCTTTCAAGCCTTCCAGGGGTCTTAAACAAGGATACCTATTTCTCCATGTGGAGAGGGGTATTGTGCAAGGAATCAAATTCAGTGGAGACGGTCCTACCTTATCCCATCTATTCTTTGCAGATGATTCCATTATGTTCTTAAAGGCTACTAAGCAAAATTGCACTACCGTAGAAAGTATTTTGACATCTTACTGCCGTAGATGCTCATGTAAGGTCGTTGTCCCCAAAGATTGTTTGACTAATTTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

138

Amino Acids

15.62

Weight (kDa)

9.45

Isoelectric Point (pI)

24.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018271)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 109
AclWI GGATC 1 cut(s) 125
AcsI RAATTY 1 cut(s) 242
AfiI CCNNNNNNNGG 2 cut(s) 109, 182
AgsI TTSAA 1 cut(s) 172
AjnI CCWGG 2 cut(s) 102, 179
Alw26I GTCTC 1 cut(s) 246
AlwI GGATC 1 cut(s) 125
AoxI GGCC 1 cut(s) 27
ApoI RAATTY 1 cut(s) 242
AspLEI GCGC 1 cut(s) 102
AspS9I GGNCC 1 cut(s) 257
AvaII GGWCC 1 cut(s) 257
BanII GRGCYC 1 cut(s) 9
BccI CCATC 1 cut(s) 279
BceAI ACGGC 1 cut(s) 345
BciT130I CCWGG 2 cut(s) 104, 181
BciVI GTATCC 1 cut(s) 191
BcoDI GTCTC 1 cut(s) 246
BfuI GTATCC 1 cut(s) 191
Bme1390I CCNGG 2 cut(s) 104, 181
Bme18I GGWCC 1 cut(s) 257
BmgT120I GGNCC 1 cut(s) 257
BmrFI CCNGG 2 cut(s) 104, 181
BmsI GCATC 1 cut(s) 356
BsaJI CCNNGG 1 cut(s) 180
BsaWI WCCGGW 1 cut(s) 129
Bsc4I CCNNNNNNNGG 2 cut(s) 109, 182
BseBI CCWGG 2 cut(s) 104, 181
BseDI CCNNGG 1 cut(s) 180
BseLI CCNNNNNNNGG 2 cut(s) 109, 182
BshFI GGCC 1 cut(s) 29
BsiSI CCGG 1 cut(s) 130
BslFI GGGAC 1 cut(s) 371
BslI CCNNNNNNNGG 2 cut(s) 109, 182
BsmAI GTCTC 1 cut(s) 246
BsmBI CGTCTC 1 cut(s) 246
BsmFI GGGAC 1 cut(s) 371
BsnI GGCC 1 cut(s) 29
Bsp1286I GDGCHC 1 cut(s) 9
Bsp143I GATC 2 cut(s) 85, 117
BspANI GGCC 1 cut(s) 29
BspPI GGATC 1 cut(s) 125
BssECI CCNNGG 1 cut(s) 180
BssMI GATC 2 cut(s) 85, 117
Bst2UI CCWGG 2 cut(s) 104, 181
Bst4CI ACNGT 2 cut(s) 257, 334
BstDEI CTNAG 1 cut(s) 315
BstHHI GCGC 1 cut(s) 102
BstKTI GATC 2 cut(s) 88, 120
BstMAI GTCTC 1 cut(s) 246
BstMBI GATC 2 cut(s) 85, 117
BstMWI GCNNNNNNNGC 1 cut(s) 366
BstNI CCWGG 2 cut(s) 104, 181
BstSCI CCNGG 2 cut(s) 102, 179
BsuI GTATCC 1 cut(s) 191
BsuRI GGCC 1 cut(s) 29
BtsIMutI CAGTG 1 cut(s) 253
CfoI GCGC 1 cut(s) 102
Cfr13I GGNCC 1 cut(s) 257
CspCI CAANNNNNGTGG 2 cut(s) 229, 264
CviAII CATG 2 cut(s) 212, 372
CviJI RGCY 4 cut(s) 7, 29, 175, 311
CviKI_1 RGCY 4 cut(s) 7, 29, 175, 311
DdeI CTNAG 1 cut(s) 315
DpnI GATC 2 cut(s) 87, 119
DpnII GATC 2 cut(s) 85, 117
Eco147I AGGCCT 1 cut(s) 29
Eco24I GRGCYC 1 cut(s) 9
Eco47I GGWCC 1 cut(s) 257
EcoRII CCWGG 2 cut(s) 102, 179
EcoT38I GRGCYC 1 cut(s) 9
Esp3I CGTCTC 1 cut(s) 246
FaeI CATG 2 cut(s) 215, 375
FaiI YATR 7 cut(s) 20, 33, 110, 137, 213, 299, 373
FaqI GGGAC 1 cut(s) 371
FatI CATG 2 cut(s) 211, 371
FriOI GRGCYC 1 cut(s) 9
GlaI GCGC 1 cut(s) 101
HaeIII GGCC 1 cut(s) 29
HapII CCGG 1 cut(s) 130
HhaI GCGC 1 cut(s) 102
Hin1II CATG 2 cut(s) 215, 375
Hin6I GCGC 1 cut(s) 100
HinP1I GCGC 1 cut(s) 100
HinfI GANTC 2 cut(s) 237, 290
HpaII CCGG 1 cut(s) 130
HpyAV CCTTC 1 cut(s) 186
HpyCH4III ACNGT 2 cut(s) 257, 334
HpyCH4V TGCA 3 cut(s) 232, 284, 327
HpyF10VI GCNNNNNNNGC 1 cut(s) 366
HpyF3I CTNAG 1 cut(s) 315
Hsp92II CATG 2 cut(s) 215, 375
HspAI GCGC 1 cut(s) 100
Kzo9I GATC 2 cut(s) 85, 117
LpnPI CCDG 6 cut(s) 89, 116, 143, 144, 166, 193
LweI GCATC 1 cut(s) 356
MalI GATC 2 cut(s) 87, 119
MboI GATC 2 cut(s) 85, 117
MhlI GDGCHC 1 cut(s) 9
MluCI AATT 5 cut(s) 39, 74, 242, 322, 406
MnlI CCTC 1 cut(s) 213
MseI TTAA 3 cut(s) 146, 189, 305
MspI CCGG 1 cut(s) 130
MspR9I CCNGG 2 cut(s) 104, 181
MvaI CCWGG 2 cut(s) 104, 181
MwoI GCNNNNNNNGC 1 cut(s) 366
NdeII GATC 2 cut(s) 85, 117
NlaIII CATG 2 cut(s) 215, 375
PceI AGGCCT 1 cut(s) 29
PfeI GAWTC 2 cut(s) 237, 290
PflMI CCANNNNNTGG 1 cut(s) 109
Psp6I CCWGG 2 cut(s) 102, 179
PspGI CCWGG 2 cut(s) 102, 179
PspPI GGNCC 1 cut(s) 257
SaqAI TTAA 3 cut(s) 146, 189, 305
Sau3AI GATC 2 cut(s) 85, 117
Sau96I GGNCC 1 cut(s) 257
ScrFI CCNGG 2 cut(s) 104, 181
SduI GDGCHC 1 cut(s) 9
SetI ASST 4 cut(s) 108, 204, 266, 381
SfaNI GCATC 1 cut(s) 356
SinI GGWCC 1 cut(s) 257
SmlI CTYRAG 1 cut(s) 8
SmoI CTYRAG 1 cut(s) 8
Sse9I AATT 5 cut(s) 39, 74, 242, 322, 406
SseBI AGGCCT 1 cut(s) 29
StuI AGGCCT 1 cut(s) 29
StyD4I CCNGG 2 cut(s) 102, 179
TaaI ACNGT 2 cut(s) 257, 334
TaqI TCGA 1 cut(s) 88
TasI AATT 5 cut(s) 39, 74, 242, 322, 406
TfiI GAWTC 2 cut(s) 237, 290
Tru1I TTAA 3 cut(s) 146, 189, 305
Tru9I TTAA 3 cut(s) 146, 189, 305
TscAI CASTG 1 cut(s) 253
TspDTI ATGAA 2 cut(s) 35, 124
TspRI CASTG 1 cut(s) 253
Van91I CCANNNNNTGG 1 cut(s) 109
VpaK11BI GGWCC 1 cut(s) 257
XapI RAATTY 1 cut(s) 242
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.