AT2G27402

function DUF861, cupin-3 (InterPro IPR008579), RmlC-like jelly roll fold (InterPro IPR014710)

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
2
Physical Location & Seq
Forward (+)
11722770 .. 11724400
1631 bp
Loading structure...
UTR
Exon/CDS
Intron
AT2G27402.1

Sequence Viewer

Length: 159 bp
ATGACCACATCATTCCCAGGTTCTGTCACTACATGTAAGAAGACAAATAACCTGTCTGTTCAGAGAGCCTTTAGGGTGACTTGTATGCAGACAGAGAAACCGTTGGAGGAGTTATACAATGTTAAAGTGGAAAGGAAAGTTTCAAAGAAACGGTTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

52

Amino Acids

6.01

Weight (kDa)

10.03

Isoelectric Point (pI)

22.59

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AflIII ACRYGT 1 cut(s) 32
AgsI TTSAA 1 cut(s) 144
AjnI CCWGG 1 cut(s) 16
AlwNI CAGNNNCTG 1 cut(s) 23
ArsI GACNNNNNNTTYG 2 cut(s) 38, 70
AsuHPI GGTGA 1 cut(s) 88
BbsI GAAGAC 1 cut(s) 47
BciT130I CCWGG 1 cut(s) 18
Bme1390I CCNGG 1 cut(s) 18
BmrFI CCNGG 1 cut(s) 18
BpiI GAAGAC 1 cut(s) 47
BsaJI CCNNGG 1 cut(s) 16
BseBI CCWGG 1 cut(s) 18
BseDI CCNNGG 1 cut(s) 16
BseRI GAGGAG 1 cut(s) 122
BssECI CCNNGG 1 cut(s) 16
Bst2UI CCWGG 1 cut(s) 18
Bst4CI ACNGT 2 cut(s) 102, 153
BstNI CCWGG 1 cut(s) 18
BstNSI RCATGY 1 cut(s) 36
BstSCI CCNGG 1 cut(s) 16
BstV2I GAAGAC 1 cut(s) 47
CaiI CAGNNNCTG 1 cut(s) 23
CviAII CATG 1 cut(s) 33
CviJI RGCY 1 cut(s) 68
CviKI_1 RGCY 1 cut(s) 68
EcoRII CCWGG 1 cut(s) 16
FaeI CATG 1 cut(s) 36
FaiI YATR 3 cut(s) 34, 86, 115
FatI CATG 1 cut(s) 32
Hin1II CATG 1 cut(s) 36
HphI GGTGA 1 cut(s) 88
Hpy188I TCNGA 1 cut(s) 63
HpyCH4III ACNGT 2 cut(s) 102, 153
HpyCH4V TGCA 1 cut(s) 88
Hsp92II CATG 1 cut(s) 36
LpnPI CCDG 3 cut(s) 3, 30, 65
MaeIII GTNAC 2 cut(s) 25, 76
MboII GAAGA 1 cut(s) 52
MmeI TCCRAC 1 cut(s) 84
MnlI CCTC 1 cut(s) 100
MseI TTAA 1 cut(s) 123
MspR9I CCNGG 1 cut(s) 18
MvaI CCWGG 1 cut(s) 18
NlaIII CATG 1 cut(s) 36
NmuCI GTSAC 2 cut(s) 25, 76
NspI RCATGY 1 cut(s) 36
PciI ACATGT 1 cut(s) 32
PscI ACATGT 1 cut(s) 32
Psp6I CCWGG 1 cut(s) 16
PspGI CCWGG 1 cut(s) 16
PstNI CAGNNNCTG 1 cut(s) 23
SaqAI TTAA 1 cut(s) 123
ScrFI CCNGG 1 cut(s) 18
SetI ASST 2 cut(s) 22, 54
SgeI CNNG 5 cut(s) 29, 30, 45, 64, 93
StyD4I CCNGG 1 cut(s) 16
TaaI ACNGT 2 cut(s) 102, 153
Tru1I TTAA 1 cut(s) 123
Tru9I TTAA 1 cut(s) 123
TseFI GTSAC 2 cut(s) 25, 76
Tsp45I GTSAC 2 cut(s) 25, 76
XceI RCATGY 1 cut(s) 36
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.