AT3G03070

Accessory subunit of the mitochondrial membrane respiratory chain NADH dehydrogenase (Complex I), that is believed not to be involved in catalysis. Complex I functions in the transfer of electrons from NADH to the respiratory chain. The immediate electron acceptor for the enzyme is believed to be ubiquinone

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
3
Physical Location & Seq
Reverse (-)
696242 .. 698164
1923 bp
Loading structure...
UTR
Exon/CDS
Intron
AT3G03070.1

Sequence Viewer

Length: 333 bp
ATGGCGTCGAATCTCCTGAAAGCCCTAATCCGATCTCAGATTCTTCCATCTTCCAGGAGGAATTTCAGTGTGGCGACCACACAGCTTGGCATTCCAACAGACGATCTAGTCGGCAATCACACCGCCAAATGGATGCAGGATAGAAGCAAGAAATCACCTATGGAACTGATTAGTGAGGTTCCACCTATCAAAGTTGATGGAAGGATTGTTGCTTGTGAAGGAGACACCAATCCGGCCCTAGGTCATCCAATCGAGTTCATATGCCTCGACCTAAATGAGCCTGCGATCTGCAAGTACTGCGGCCTTCGTTATGTTCAAGATCATCACCATTGA

Protein Analysis

110

Amino Acids

12.23

Weight (kDa)

6.95

Isoelectric Point (pI)

51.73

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
zf-CHCC PF10276 67 - 104 8e-15 Zinc-finger domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012538)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 107
AciI CCGC 2 cut(s) 123, 300
AcsI RAATTY 1 cut(s) 61
AcyI GRCGYC 1 cut(s) 5
AfaI GTAC 1 cut(s) 296
AfiI CCNNNNNNNGG 2 cut(s) 129, 239
AgsI TTSAA 1 cut(s) 317
AjnI CCWGG 1 cut(s) 53
AluBI AGCT 1 cut(s) 85
AluI AGCT 1 cut(s) 85
Alw26I GTCTC 1 cut(s) 216
AoxI GGCC 2 cut(s) 234, 301
ApoI RAATTY 1 cut(s) 61
AspA2I CCTAGG 1 cut(s) 238
AspS9I GGNCC 1 cut(s) 235
AsuHPI GGTGA 2 cut(s) 147, 317
AvrII CCTAGG 1 cut(s) 238
BccI CCATC 2 cut(s) 55, 191
BciT130I CCWGG 1 cut(s) 55
BcoDI GTCTC 1 cut(s) 216
BfaI CTAG 2 cut(s) 107, 239
BisI GCNGC 1 cut(s) 301
BlnI CCTAGG 1 cut(s) 238
BlsI GCNGC 1 cut(s) 302
BmcAI AGTACT 1 cut(s) 296
Bme1390I CCNGG 1 cut(s) 55
BmgT120I GGNCC 1 cut(s) 235
BmiI GGNNCC 1 cut(s) 180
BmrFI CCNGG 1 cut(s) 55
BmsI GCATC 1 cut(s) 123
BsaHI GRCGYC 1 cut(s) 5
BsaJI CCNNGG 1 cut(s) 238
Bsc4I CCNNNNNNNGG 2 cut(s) 129, 239
BseBI CCWGG 1 cut(s) 55
BseDI CCNNGG 1 cut(s) 238
BseGI GGATG 2 cut(s) 138, 244
BseLI CCNNNNNNNGG 2 cut(s) 129, 239
BseMII CTCAG 1 cut(s) 50
BshFI GGCC 2 cut(s) 236, 303
BsiSI CCGG 1 cut(s) 233
BslI CCNNNNNNNGG 2 cut(s) 129, 239
BsmAI GTCTC 1 cut(s) 216
BsmI GAATGC 1 cut(s) 90
BsnI GGCC 2 cut(s) 236, 303
Bsp143I GATC 4 cut(s) 32, 103, 285, 319
BspACI CCGC 2 cut(s) 123, 300
BspANI GGCC 2 cut(s) 236, 303
BspCNI CTCAG 1 cut(s) 49
BspLI GGNNCC 1 cut(s) 180
BssECI CCNNGG 1 cut(s) 238
BssMI GATC 4 cut(s) 32, 103, 285, 319
BssNI GRCGYC 1 cut(s) 5
BssT1I CCWWGG 1 cut(s) 238
Bst2UI CCWGG 1 cut(s) 55
BstACI GRCGYC 1 cut(s) 5
BstAPI GCANNNNNTGC 1 cut(s) 297
BstC8I GCNNGC 1 cut(s) 282
BstDEI CTNAG 1 cut(s) 36
BstF5I GGATG 2 cut(s) 138, 244
BstKTI GATC 4 cut(s) 35, 106, 288, 322
BstMAI GTCTC 1 cut(s) 216
BstMBI GATC 4 cut(s) 32, 103, 285, 319
BstMWI GCNNNNNNNGC 1 cut(s) 297
BstNI CCWGG 1 cut(s) 55
BstSCI CCNGG 1 cut(s) 53
BsuRI GGCC 2 cut(s) 236, 303
BtsCI GGATG 2 cut(s) 138, 244
BtsIMutI CAGTG 1 cut(s) 73
Cac8I GCNNGC 1 cut(s) 282
Cfr13I GGNCC 1 cut(s) 235
Csp6I GTAC 1 cut(s) 295
CspCI CAANNNNNGTGG 2 cut(s) 67, 102
CviJI RGCY 5 cut(s) 23, 85, 236, 280, 303
CviKI_1 RGCY 5 cut(s) 23, 85, 236, 280, 303
CviQI GTAC 1 cut(s) 295
DdeI CTNAG 1 cut(s) 36
DpnI GATC 4 cut(s) 34, 105, 287, 321
DpnII GATC 4 cut(s) 32, 103, 285, 319
DrdI GACNNNNNNGTC 1 cut(s) 107
DseDI GACNNNNNNGTC 1 cut(s) 107
Eco130I CCWWGG 1 cut(s) 238
EcoRII CCWGG 1 cut(s) 53
EcoT14I CCWWGG 1 cut(s) 238
ErhI CCWWGG 1 cut(s) 238
FaiI YATR 4 cut(s) 161, 260, 262, 312
FauNDI CATATG 1 cut(s) 260
Fnu4HI GCNGC 1 cut(s) 301
FokI GGATG 2 cut(s) 145, 231
Fsp4HI GCNGC 1 cut(s) 301
FspBI CTAG 2 cut(s) 107, 239
GluI GCNGC 1 cut(s) 301
HaeIII GGCC 2 cut(s) 236, 303
HapII CCGG 1 cut(s) 233
Hin1I GRCGYC 1 cut(s) 5
HinfI GANTC 2 cut(s) 10, 40
HpaII CCGG 1 cut(s) 233
HphI GGTGA 2 cut(s) 147, 317
Hpy188I TCNGA 2 cut(s) 32, 39
Hpy188III TCNNGA 2 cut(s) 16, 317
Hpy99I CGWCG 1 cut(s) 10
HpyAV CCTTC 3 cut(s) 195, 212, 314
HpyCH4V TGCA 2 cut(s) 136, 291
HpyF10VI GCNNNNNNNGC 1 cut(s) 297
HpyF3I CTNAG 1 cut(s) 36
Hsp92I GRCGYC 1 cut(s) 5
Kzo9I GATC 4 cut(s) 32, 103, 285, 319
LpnPI CCDG 6 cut(s) 29, 40, 67, 122, 246, 294
LweI GCATC 1 cut(s) 123
MaeI CTAG 2 cut(s) 107, 239
MalI GATC 4 cut(s) 34, 105, 287, 321
MboI GATC 4 cut(s) 32, 103, 285, 319
MboII GAAGA 2 cut(s) 35, 42
MluCI AATT 1 cut(s) 61
MmeI TCCRAC 1 cut(s) 119
MnlI CCTC 3 cut(s) 51, 169, 275
MspI CCGG 1 cut(s) 233
MspR9I CCNGG 1 cut(s) 55
Mva1269I GAATGC 1 cut(s) 90
MvaI CCWGG 1 cut(s) 55
MwoI GCNNNNNNNGC 1 cut(s) 297
NdeI CATATG 1 cut(s) 260
NdeII GATC 4 cut(s) 32, 103, 285, 319
NlaIV GGNNCC 1 cut(s) 180
PctI GAATGC 1 cut(s) 90
PfeI GAWTC 2 cut(s) 10, 40
PfoI TCCNGGA 1 cut(s) 53
PkrI GCNGC 1 cut(s) 302
Psp6I CCWGG 1 cut(s) 53
PspGI CCWGG 1 cut(s) 53
PspN4I GGNNCC 1 cut(s) 180
PspPI GGNCC 1 cut(s) 235
RsaI GTAC 1 cut(s) 296
RsaNI GTAC 1 cut(s) 295
SatI GCNGC 1 cut(s) 301
Sau3AI GATC 4 cut(s) 32, 103, 285, 319
Sau96I GGNCC 1 cut(s) 235
ScaI AGTACT 1 cut(s) 296
ScrFI CCNGG 1 cut(s) 55
SetI ASST 6 cut(s) 87, 160, 180, 187, 244, 273
SfaNI GCATC 1 cut(s) 123
Sse9I AATT 1 cut(s) 61
SsiI CCGC 2 cut(s) 123, 300
SspMI CTAG 2 cut(s) 107, 239
StyD4I CCNGG 1 cut(s) 53
StyI CCWWGG 1 cut(s) 238
TaqI TCGA 3 cut(s) 8, 252, 267
TasI AATT 1 cut(s) 61
TatI WGTACW 1 cut(s) 294
TauI GCSGC 1 cut(s) 303
TfiI GAWTC 2 cut(s) 10, 40
TscAI CASTG 1 cut(s) 73
TspDTI ATGAA 1 cut(s) 247
TspRI CASTG 1 cut(s) 73
XapI RAATTY 1 cut(s) 61
XmaJI CCTAGG 1 cut(s) 238
XspI CTAG 2 cut(s) 107, 239
ZrmI AGTACT 1 cut(s) 296
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.