AT3G05937

No description available

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
3
Physical Location & Seq
Reverse (-)
1775766 .. 1776840
1075 bp
Loading structure...
UTR
Exon/CDS
Intron
AT3G05937.1

Sequence Viewer

Length: 162 bp
ATGAAGAGAGTGGTGAAGAAAGTTGTTTGTATGAGGTTGAAATCTGCTAGAAGATTGAAACGCGTCGTTTGGTCGCGGCTGAAAACGGCGTTTTTCTACCGCCGTAGACGTTTCCTTCGTCTCCTTCATCCAAACAAATCCTCTTCCTACTGTTTCTACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

53

Amino Acids

6.67

Weight (kDa)

11.94

Isoelectric Point (pI)

90.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012023)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 106
AccII CGCG 2 cut(s) 63, 76
AciI CCGC 2 cut(s) 76, 100
AflIII ACRYGT 1 cut(s) 61
AgsI TTSAA 2 cut(s) 40, 58
Alw26I GTCTC 1 cut(s) 125
ArsI GACNNNNNNTTYG 2 cut(s) 99, 131
AsuHPI GGTGA 1 cut(s) 25
BceAI ACGGC 2 cut(s) 87, 102
BcoDI GTCTC 1 cut(s) 125
BfaI CTAG 2 cut(s) 48, 160
BisI GCNGC 1 cut(s) 77
BlsI GCNGC 1 cut(s) 78
BseGI GGATG 1 cut(s) 127
Bsh1236I CGCG 2 cut(s) 63, 76
BsmAI GTCTC 1 cut(s) 125
BsmBI CGTCTC 1 cut(s) 125
BspACI CCGC 2 cut(s) 76, 100
BspFNI CGCG 2 cut(s) 63, 76
Bst4CI ACNGT 1 cut(s) 152
Bst6I CTCTTC 1 cut(s) 148
BstF5I GGATG 1 cut(s) 127
BstFNI CGCG 2 cut(s) 63, 76
BstMAI GTCTC 1 cut(s) 125
BstUI CGCG 2 cut(s) 63, 76
BtsCI GGATG 1 cut(s) 127
CseI GACGC 1 cut(s) 52
CviJI RGCY 1 cut(s) 79
CviKI_1 RGCY 1 cut(s) 79
Eam1104I CTCTTC 1 cut(s) 148
EarI CTCTTC 1 cut(s) 148
Esp3I CGTCTC 1 cut(s) 125
FaiI YATR 1 cut(s) 32
FblI GTMKAC 1 cut(s) 106
Fnu4HI GCNGC 1 cut(s) 77
FokI GGATG 1 cut(s) 114
Fsp4HI GCNGC 1 cut(s) 77
FspBI CTAG 2 cut(s) 48, 160
GluI GCNGC 1 cut(s) 77
HgaI GACGC 1 cut(s) 52
HphI GGTGA 1 cut(s) 25
Hpy166II GTNNAC 1 cut(s) 107
Hpy8I GTNNAC 1 cut(s) 107
Hpy99I CGWCG 1 cut(s) 68
HpyAV CCTTC 2 cut(s) 125, 134
HpyCH4III ACNGT 1 cut(s) 152
HpyCH4IV ACGT 1 cut(s) 109
HpySE526I ACGT 1 cut(s) 109
MaeI CTAG 2 cut(s) 48, 160
MaeII ACGT 1 cut(s) 109
MboII GAAGA 4 cut(s) 16, 28, 63, 135
MluI ACGCGT 1 cut(s) 61
MnlI CCTC 2 cut(s) 27, 151
MvnI CGCG 2 cut(s) 63, 76
PcsI WCGNNNNNNNCGW 1 cut(s) 115
PkrI GCNGC 1 cut(s) 78
SatI GCNGC 1 cut(s) 77
SetI ASST 2 cut(s) 38, 112
SgeI CNNG 3 cut(s) 60, 74, 87
SsiI CCGC 2 cut(s) 76, 100
SspMI CTAG 2 cut(s) 48, 160
TaaI ACNGT 1 cut(s) 152
TaiI ACGT 1 cut(s) 112
TauI GCSGC 1 cut(s) 79
TspDTI ATGAA 2 cut(s) 17, 116
XmiI GTMKAC 1 cut(s) 106
XspI CTAG 2 cut(s) 48, 160
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.