AT3G07230

Wound-induced basic

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
3
OG0017566
Physical Location & Seq
Forward (+)
2299773 .. 2300531
759 bp
Loading structure...
UTR
Exon/CDS
Intron
AT3G07230.1

Sequence Viewer

Length: 141 bp
ATGATCTATGATGTGAACTCTGGTCTATTCAGATCCTTCCTGAGCCAGAAGGGTAGCTCGTCCGACAAAAGGAAAATGGAAGATAAGCCAAGAGAACAGAAGCCCAAAGCCAGCGACAACAAACCTGTTATGAATGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Wound_ind

Protein Analysis

46

Amino Acids

5.3

Weight (kDa)

9.52

Isoelectric Point (pI)

56.83

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Wound_ind PF08186 1 - 46 8.3e-22 Wound-inducible basic protein family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017566)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G07230
prunus_persica Prupe.8G198600_v2.0.a1
pyrus_communis pycom10g13770
rosa_chinensis RchiOBHm_Chr1g0355701 RchiOBHm_Chr6g0284071
rosa_laevigata RLG00000000909 RLG00000013723 RLG00000034261
rosa_roxburghii Rroxscaffold_6G00395690 Rroxscaffold_7G00184960
rosa_rugosa Rorug06G0160200
rosa_samantha Rh6DG016100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 27
AfiI CCNNNNNNNGG 1 cut(s) 69
AluBI AGCT 1 cut(s) 57
AluI AGCT 1 cut(s) 57
AlwI GGATC 1 cut(s) 27
Bpu10I CCTNAGC 1 cut(s) 41
Bsc4I CCNNNNNNNGG 1 cut(s) 69
BseLI CCNNNNNNNGG 1 cut(s) 69
BseMII CTCAG 1 cut(s) 32
BslI CCNNNNNNNGG 1 cut(s) 69
Bsp143I GATC 2 cut(s) 3, 32
BspCNI CTCAG 1 cut(s) 33
BspPI GGATC 1 cut(s) 27
BssMI GATC 2 cut(s) 3, 32
BstC8I GCNNGC 1 cut(s) 112
BstDEI CTNAG 1 cut(s) 41
BstKTI GATC 2 cut(s) 6, 35
BstMBI GATC 2 cut(s) 3, 32
BstX2I RGATCY 1 cut(s) 32
BstYI RGATCY 1 cut(s) 32
Cac8I GCNNGC 1 cut(s) 112
CviJI RGCY 5 cut(s) 45, 57, 88, 103, 110
CviKI_1 RGCY 5 cut(s) 45, 57, 88, 103, 110
DdeI CTNAG 1 cut(s) 41
DpnI GATC 2 cut(s) 5, 34
DpnII GATC 2 cut(s) 3, 32
FaiI YATR 2 cut(s) 9, 131
Hpy166II GTNNAC 1 cut(s) 16
Hpy188I TCNGA 2 cut(s) 32, 64
Hpy188III TCNNGA 1 cut(s) 40
Hpy8I GTNNAC 1 cut(s) 16
HpyAV CCTTC 2 cut(s) 43, 46
HpyF3I CTNAG 1 cut(s) 41
Kzo9I GATC 2 cut(s) 3, 32
LpnPI CCDG 4 cut(s) 6, 53, 59, 124
MalI GATC 2 cut(s) 5, 34
MboI GATC 2 cut(s) 3, 32
MboII GAAGA 1 cut(s) 92
MflI RGATCY 1 cut(s) 32
MmeI TCCRAC 1 cut(s) 87
NdeII GATC 2 cut(s) 3, 32
PsuI RGATCY 1 cut(s) 32
Sau3AI GATC 2 cut(s) 3, 32
SetI ASST 2 cut(s) 59, 127
SgeI CNNG 7 cut(s) 33, 52, 58, 70, 102, 123, 137
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.