Rroxscaffold_7G00184960

Wound-inducible basic protein family

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
Physical Location & Seq
Forward (+)
24251664 .. 24253204
1541 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00184960.1

Sequence Viewer

Length: 201 bp
ATGATCTACGACGTCAACTCCCCTCTTTTCAGGTCCTTCCTCAGCCAGAAGGGTGGCTCCTCCGATAAGAGGTTTACGCTGTGTGTTAAGGAGCATCAAGCTGTGGTGGGGATTGTACAGCTGTTAAAGAAGATGGAAGAGCAGAAGCCAAAGGAACACAGGCCCAAGGCCAATGAGAACAAGCCCGTTATGAATGAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

66

Amino Acids

7.61

Weight (kDa)

9.46

Isoelectric Point (pI)

47.75

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Wound_ind PF08186 1 - 25 3.7e-11 Wound-inducible basic protein family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017566)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 15
AcyI GRCGYC 1 cut(s) 12
AfaI GTAC 1 cut(s) 117
AfiI CCNNNNNNNGG 1 cut(s) 69
AluBI AGCT 2 cut(s) 101, 121
AluI AGCT 2 cut(s) 101, 121
AoxI GGCC 2 cut(s) 161, 168
AspS9I GGNCC 2 cut(s) 33, 162
AvaII GGWCC 1 cut(s) 33
BbvCI CCTCAGC 1 cut(s) 41
BccI CCATC 1 cut(s) 127
Bme18I GGWCC 1 cut(s) 33
BmgT120I GGNCC 2 cut(s) 33, 162
BmiI GGNNCC 1 cut(s) 58
BmsI GCATC 1 cut(s) 103
Bpu10I CCTNAGC 1 cut(s) 41
BsaHI GRCGYC 1 cut(s) 12
BsaJI CCNNGG 1 cut(s) 165
BsaXI ACNNNNNCTCC 1 cut(s) 32
Bsc4I CCNNNNNNNGG 1 cut(s) 69
BseDI CCNNGG 1 cut(s) 165
BseLI CCNNNNNNNGG 1 cut(s) 69
BseMII CTCAG 1 cut(s) 55
BseRI GAGGAG 1 cut(s) 49
BshFI GGCC 2 cut(s) 163, 170
BslI CCNNNNNNNGG 1 cut(s) 69
BsnI GGCC 2 cut(s) 163, 170
Bsp1407I TGTACA 1 cut(s) 115
Bsp143I GATC 1 cut(s) 3
BspANI GGCC 2 cut(s) 163, 170
BspCNI CTCAG 1 cut(s) 54
BspLI GGNNCC 1 cut(s) 58
BspQI GCTCTTC 1 cut(s) 132
BsrGI TGTACA 1 cut(s) 115
BssECI CCNNGG 1 cut(s) 165
BssMI GATC 1 cut(s) 3
BssNI GRCGYC 1 cut(s) 12
BssT1I CCWWGG 1 cut(s) 165
Bst6I CTCTTC 1 cut(s) 132
BstACI GRCGYC 1 cut(s) 12
BstAUI TGTACA 1 cut(s) 115
BstDEI CTNAG 1 cut(s) 41
BstKTI GATC 1 cut(s) 6
BstMBI GATC 1 cut(s) 3
BstXI CCANNNNNNTGG 1 cut(s) 53
BsuRI GGCC 2 cut(s) 163, 170
Cfr13I GGNCC 2 cut(s) 33, 162
Csp6I GTAC 1 cut(s) 116
CviJI RGCY 8 cut(s) 45, 57, 101, 121, 148, 163, 170, 184
CviKI_1 RGCY 8 cut(s) 45, 57, 101, 121, 148, 163, 170, 184
CviQI GTAC 1 cut(s) 116
DdeI CTNAG 1 cut(s) 41
DpnI GATC 1 cut(s) 5
DpnII GATC 1 cut(s) 3
Eam1104I CTCTTC 1 cut(s) 132
EarI CTCTTC 1 cut(s) 132
Eco130I CCWWGG 1 cut(s) 165
Eco47I GGWCC 1 cut(s) 33
EcoO109I RGGNCCY 1 cut(s) 33
EcoT14I CCWWGG 1 cut(s) 165
ErhI CCWWGG 1 cut(s) 165
FaiI YATR 1 cut(s) 191
HaeIII GGCC 2 cut(s) 163, 170
Hin1I GRCGYC 1 cut(s) 12
HincII GTYRAC 1 cut(s) 16
HindII GTYRAC 1 cut(s) 16
Hpy166II GTNNAC 2 cut(s) 16, 75
Hpy188I TCNGA 1 cut(s) 64
Hpy8I GTNNAC 2 cut(s) 16, 75
Hpy99I CGWCG 1 cut(s) 14
HpyAV CCTTC 2 cut(s) 43, 46
HpyCH4IV ACGT 1 cut(s) 12
HpyF3I CTNAG 1 cut(s) 41
HpySE526I ACGT 1 cut(s) 12
Hsp92I GRCGYC 1 cut(s) 12
Kzo9I GATC 1 cut(s) 3
LguI GCTCTTC 1 cut(s) 132
LmnI GCTCC 2 cut(s) 62, 91
LpnPI CCDG 3 cut(s) 16, 59, 145
LweI GCATC 1 cut(s) 103
MaeII ACGT 1 cut(s) 12
MalI GATC 1 cut(s) 5
MboI GATC 1 cut(s) 3
MboII GAAGA 2 cut(s) 142, 149
MnlI CCTC 4 cut(s) 33, 50, 63, 70
MseI TTAA 2 cut(s) 87, 125
MspA1I CMGCKG 1 cut(s) 121
NdeII GATC 1 cut(s) 3
NlaIV GGNNCC 1 cut(s) 58
PciSI GCTCTTC 1 cut(s) 132
PpuMI RGGWCCY 1 cut(s) 33
Psp5II RGGWCCY 1 cut(s) 33
PspN4I GGNNCC 1 cut(s) 58
PspPI GGNCC 2 cut(s) 33, 162
PspPPI RGGWCCY 1 cut(s) 33
PvuII CAGCTG 1 cut(s) 121
RsaI GTAC 1 cut(s) 117
RsaNI GTAC 1 cut(s) 116
SapI GCTCTTC 1 cut(s) 132
SaqAI TTAA 2 cut(s) 87, 125
Sau3AI GATC 1 cut(s) 3
Sau96I GGNCC 2 cut(s) 33, 162
SetI ASST 5 cut(s) 15, 35, 74, 103, 123
SfaNI GCATC 1 cut(s) 103
SgeI CNNG 7 cut(s) 43, 58, 110, 172, 178, 193, 197
SinI GGWCC 1 cut(s) 33
StyI CCWWGG 1 cut(s) 165
TaiI ACGT 1 cut(s) 15
TatI WGTACW 1 cut(s) 115
Tru1I TTAA 2 cut(s) 87, 125
Tru9I TTAA 2 cut(s) 87, 125
VpaK11BI GGWCC 1 cut(s) 33
ZraI GACGTC 1 cut(s) 13
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.