RchiOBHm_Chr6g0284071

Wound-inducible basic protein family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
OG0017566
Physical Location & Seq
Reverse (-)
47366837 .. 47368298
1462 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ25475

Sequence Viewer

Length: 144 bp
ATGATCTACGACGTCAACTCCCCTCTTTTCAGGTCCTTCCTCAGCCAGAAGGGTGGCTCCTCCGATAAGAGGAAGATGGAAGAGCAGAAGCCGAAGGAACACAGGCCCAAGGCCAATGAGAACAAGCCCGTTATGAATGAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Wound_ind

Protein Analysis

47

Amino Acids

5.51

Weight (kDa)

9.52

Isoelectric Point (pI)

74.06

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Wound_ind PF08186 1 - 47 1.1e-21 Wound-inducible basic protein family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017566)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G07230
prunus_persica Prupe.8G198600_v2.0.a1
pyrus_communis pycom10g13770
rosa_chinensis RchiOBHm_Chr1g0355701 RchiOBHm_Chr6g0284071
rosa_laevigata RLG00000000909 RLG00000013723 RLG00000034261
rosa_roxburghii Rroxscaffold_6G00395690 Rroxscaffold_7G00184960
rosa_rugosa Rorug06G0160200
rosa_samantha Rh6DG016100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 15
AcyI GRCGYC 1 cut(s) 12
AfiI CCNNNNNNNGG 1 cut(s) 69
AoxI GGCC 2 cut(s) 104, 111
AspS9I GGNCC 2 cut(s) 33, 105
AvaII GGWCC 1 cut(s) 33
BbvCI CCTCAGC 1 cut(s) 41
BccI CCATC 1 cut(s) 70
Bme18I GGWCC 1 cut(s) 33
BmgT120I GGNCC 2 cut(s) 33, 105
BmiI GGNNCC 1 cut(s) 58
Bpu10I CCTNAGC 1 cut(s) 41
BsaHI GRCGYC 1 cut(s) 12
BsaJI CCNNGG 1 cut(s) 108
BsaXI ACNNNNNCTCC 1 cut(s) 32
Bsc4I CCNNNNNNNGG 1 cut(s) 69
BseDI CCNNGG 1 cut(s) 108
BseLI CCNNNNNNNGG 1 cut(s) 69
BseMII CTCAG 1 cut(s) 55
BseRI GAGGAG 1 cut(s) 49
BshFI GGCC 2 cut(s) 106, 113
BslI CCNNNNNNNGG 1 cut(s) 69
BsnI GGCC 2 cut(s) 106, 113
Bsp143I GATC 1 cut(s) 3
BspANI GGCC 2 cut(s) 106, 113
BspCNI CTCAG 1 cut(s) 54
BspLI GGNNCC 1 cut(s) 58
BspQI GCTCTTC 1 cut(s) 75
BssECI CCNNGG 1 cut(s) 108
BssMI GATC 1 cut(s) 3
BssNI GRCGYC 1 cut(s) 12
BssT1I CCWWGG 1 cut(s) 108
Bst6I CTCTTC 1 cut(s) 75
BstACI GRCGYC 1 cut(s) 12
BstDEI CTNAG 1 cut(s) 41
BstKTI GATC 1 cut(s) 6
BstMBI GATC 1 cut(s) 3
BstXI CCANNNNNNTGG 1 cut(s) 53
BsuRI GGCC 2 cut(s) 106, 113
Cfr13I GGNCC 2 cut(s) 33, 105
CviJI RGCY 6 cut(s) 45, 57, 91, 106, 113, 127
CviKI_1 RGCY 6 cut(s) 45, 57, 91, 106, 113, 127
DdeI CTNAG 1 cut(s) 41
DpnI GATC 1 cut(s) 5
DpnII GATC 1 cut(s) 3
Eam1104I CTCTTC 1 cut(s) 75
EarI CTCTTC 1 cut(s) 75
Eco130I CCWWGG 1 cut(s) 108
Eco47I GGWCC 1 cut(s) 33
EcoO109I RGGNCCY 1 cut(s) 33
EcoT14I CCWWGG 1 cut(s) 108
ErhI CCWWGG 1 cut(s) 108
FaiI YATR 1 cut(s) 134
HaeIII GGCC 2 cut(s) 106, 113
Hin1I GRCGYC 1 cut(s) 12
HincII GTYRAC 1 cut(s) 16
HindII GTYRAC 1 cut(s) 16
Hpy166II GTNNAC 1 cut(s) 16
Hpy188I TCNGA 1 cut(s) 64
Hpy8I GTNNAC 1 cut(s) 16
Hpy99I CGWCG 1 cut(s) 14
HpyAV CCTTC 3 cut(s) 43, 46, 88
HpyCH4IV ACGT 1 cut(s) 12
HpyF3I CTNAG 1 cut(s) 41
HpySE526I ACGT 1 cut(s) 12
Hsp92I GRCGYC 1 cut(s) 12
Kzo9I GATC 1 cut(s) 3
LguI GCTCTTC 1 cut(s) 75
LmnI GCTCC 1 cut(s) 62
LpnPI CCDG 3 cut(s) 16, 59, 88
MaeII ACGT 1 cut(s) 12
MalI GATC 1 cut(s) 5
MboI GATC 1 cut(s) 3
MboII GAAGA 2 cut(s) 85, 92
MnlI CCTC 4 cut(s) 33, 50, 63, 70
NdeII GATC 1 cut(s) 3
NlaIV GGNNCC 1 cut(s) 58
PciSI GCTCTTC 1 cut(s) 75
PpuMI RGGWCCY 1 cut(s) 33
Psp5II RGGWCCY 1 cut(s) 33
PspN4I GGNNCC 1 cut(s) 58
PspPI GGNCC 2 cut(s) 33, 105
PspPPI RGGWCCY 1 cut(s) 33
SapI GCTCTTC 1 cut(s) 75
Sau3AI GATC 1 cut(s) 3
Sau96I GGNCC 2 cut(s) 33, 105
SetI ASST 2 cut(s) 15, 35
SgeI CNNG 6 cut(s) 43, 58, 115, 121, 136, 140
SinI GGWCC 1 cut(s) 33
StyI CCWWGG 1 cut(s) 108
TaiI ACGT 1 cut(s) 15
VpaK11BI GGWCC 1 cut(s) 33
ZraI GACGTC 1 cut(s) 13
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.