Prupe.8G198600_v2.0.a1

Wound-induced basic protein

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp08
Physical Location & Seq
Reverse (-)
18901503 .. 18903140
1638 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.8G198600.1

Sequence Viewer

Length: 144 bp
ATGATCTACGACGTCAACTCACCCCTCTTCCGATCCTTCCTCAGCCAGAAGGGAGGCTCCTCCGATAAGAGGAAGTTGGAAGAGCAGAAGCCCAAGGAACATAGGCCGAAGGCCAGTGAGAACAAGCCCGTAATGAATGAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

48

Amino Acids

5.46

Weight (kDa)

9.52

Isoelectric Point (pI)

69.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017566)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 15
AclWI GGATC 1 cut(s) 27
AcyI GRCGYC 1 cut(s) 12
AfiI CCNNNNNNNGG 1 cut(s) 69
AlwI GGATC 1 cut(s) 27
AoxI GGCC 2 cut(s) 104, 111
AsuHPI GGTGA 1 cut(s) 12
BbvCI CCTCAGC 1 cut(s) 41
BmiI GGNNCC 1 cut(s) 58
Bpu10I CCTNAGC 1 cut(s) 41
BsaHI GRCGYC 1 cut(s) 12
BsaJI CCNNGG 1 cut(s) 93
Bsc4I CCNNNNNNNGG 1 cut(s) 69
Bse1I ACTGG 1 cut(s) 114
BseDI CCNNGG 1 cut(s) 93
BseLI CCNNNNNNNGG 1 cut(s) 69
BseMII CTCAG 1 cut(s) 55
BseNI ACTGG 1 cut(s) 114
BseRI GAGGAG 1 cut(s) 49
BshFI GGCC 2 cut(s) 106, 113
BslI CCNNNNNNNGG 1 cut(s) 69
BsnI GGCC 2 cut(s) 106, 113
Bsp143I GATC 2 cut(s) 3, 32
BspANI GGCC 2 cut(s) 106, 113
BspCNI CTCAG 1 cut(s) 54
BspLI GGNNCC 1 cut(s) 58
BspPI GGATC 1 cut(s) 27
BspQI GCTCTTC 1 cut(s) 75
BsrI ACTGG 1 cut(s) 114
BssECI CCNNGG 1 cut(s) 93
BssMI GATC 2 cut(s) 3, 32
BssNI GRCGYC 1 cut(s) 12
BssT1I CCWWGG 1 cut(s) 93
Bst6I CTCTTC 2 cut(s) 32, 75
BstACI GRCGYC 1 cut(s) 12
BstDEI CTNAG 1 cut(s) 41
BstKTI GATC 2 cut(s) 6, 35
BstMBI GATC 2 cut(s) 3, 32
BsuRI GGCC 2 cut(s) 106, 113
BtsIMutI CAGTG 1 cut(s) 121
CviJI RGCY 6 cut(s) 45, 57, 91, 106, 113, 127
CviKI_1 RGCY 6 cut(s) 45, 57, 91, 106, 113, 127
DdeI CTNAG 1 cut(s) 41
DpnI GATC 2 cut(s) 5, 34
DpnII GATC 2 cut(s) 3, 32
Eam1104I CTCTTC 2 cut(s) 32, 75
EarI CTCTTC 2 cut(s) 32, 75
Eco130I CCWWGG 1 cut(s) 93
EcoT14I CCWWGG 1 cut(s) 93
ErhI CCWWGG 1 cut(s) 93
FaiI YATR 1 cut(s) 102
HaeIII GGCC 2 cut(s) 106, 113
Hin1I GRCGYC 1 cut(s) 12
HincII GTYRAC 1 cut(s) 16
HindII GTYRAC 1 cut(s) 16
HphI GGTGA 1 cut(s) 12
Hpy166II GTNNAC 1 cut(s) 16
Hpy188I TCNGA 2 cut(s) 32, 64
Hpy8I GTNNAC 1 cut(s) 16
Hpy99I CGWCG 1 cut(s) 14
HpyAV CCTTC 3 cut(s) 43, 46, 103
HpyCH4IV ACGT 1 cut(s) 12
HpyF3I CTNAG 1 cut(s) 41
HpySE526I ACGT 1 cut(s) 12
Hsp92I GRCGYC 1 cut(s) 12
Kzo9I GATC 2 cut(s) 3, 32
LguI GCTCTTC 1 cut(s) 75
LmnI GCTCC 1 cut(s) 62
LpnPI CCDG 2 cut(s) 59, 127
MaeII ACGT 1 cut(s) 12
MalI GATC 2 cut(s) 5, 34
MboI GATC 2 cut(s) 3, 32
MboII GAAGA 2 cut(s) 19, 92
MmeI TCCRAC 1 cut(s) 57
MnlI CCTC 5 cut(s) 35, 47, 50, 63, 70
NdeII GATC 2 cut(s) 3, 32
NlaIV GGNNCC 1 cut(s) 58
PciSI GCTCTTC 1 cut(s) 75
PspN4I GGNNCC 1 cut(s) 58
SapI GCTCTTC 1 cut(s) 75
Sau3AI GATC 2 cut(s) 3, 32
SetI ASST 1 cut(s) 15
SgeI CNNG 5 cut(s) 58, 106, 126, 136, 140
StyI CCWWGG 1 cut(s) 93
TaiI ACGT 1 cut(s) 15
TscAI CASTG 1 cut(s) 121
TspRI CASTG 1 cut(s) 121
ZraI GACGTC 1 cut(s) 13
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.