Basic Information

Type: gene

Biological Identity

Species

arabidopsis_thaliana

Chromosome

Orthogroup ID

OG0017901

Physical Location & Seq

Genomic Coordinates Reverse (-)

3994340 .. 3995671

Gene Structure 1332 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

AT3G12587.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 114 bp

ATGATCGATGATCAGGACTTGGGGTTTATTGCCAACTTTCTTGGCATCTTCATCTTCGCATTGGTAATTGCTTATCACTACGTAACTGCTGATCCCAAATACGAAGCCACTTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Ost4

Protein Analysis

37

Amino Acids

4.2

Weight (kDa)

4.05

Isoelectric Point (pI)

17.16

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Ost4	PF10215	1 - 33	5.4e-16	Oligosaccaryltransferase

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017901)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G12587
malus_domestica	MD01G1125600.v1.1 MD07G1195100.v1.1 MD07G1195400.v1.1
prunus_persica	Prupe.2G232600_v2.0.a1 Prupe.2G232600_v2.0.a1
rosa_chinensis	RchiOBHm_Chr1g0366451
rosa_multiflora	Rmu_ssc0000250.1_g000017
rosa_roxburghii	Rroxscaffold_4G00289930 Rroxscaffold_4G00290190
rosa_samantha	Rh1DG331100

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	86
AlwI	GGATC	1 cut(s)	86
BclI	TGATCA	1 cut(s)	10
BmsI	GCATC	1 cut(s)	54
Bsa29I	ATCGAT	1 cut(s)	6
BsaAI	YACGTR	1 cut(s)	82
BseCI	ATCGAT	1 cut(s)	6
BshVI	ATCGAT	1 cut(s)	6
Bsp143I	GATC	3 cut(s)	3, 10, 91
BspDI	ATCGAT	1 cut(s)	6
BspPI	GGATC	1 cut(s)	86
BssMI	GATC	3 cut(s)	3, 10, 91
BstBAI	YACGTR	1 cut(s)	82
BstKTI	GATC	3 cut(s)	6, 13, 94
BstMBI	GATC	3 cut(s)	3, 10, 91
BstSNI	TACGTA	1 cut(s)	82
Bsu15I	ATCGAT	1 cut(s)	6
BsuTUI	ATCGAT	1 cut(s)	6
ClaI	ATCGAT	1 cut(s)	6
CviJI	RGCY	1 cut(s)	107
CviKI_1	RGCY	1 cut(s)	107
DpnI	GATC	3 cut(s)	5, 12, 93
DpnII	GATC	3 cut(s)	3, 10, 91
Eco105I	TACGTA	1 cut(s)	82
FbaI	TGATCA	1 cut(s)	10
FspEI	CC	8 cut(s)	5, 6, 7, 27, 46, 47, 108, 109
Hpy188III	TCNNGA	1 cut(s)	14
HpyCH4IV	ACGT	1 cut(s)	81
HpySE526I	ACGT	1 cut(s)	81
Ksp22I	TGATCA	1 cut(s)	10
Kzo9I	GATC	3 cut(s)	3, 10, 91
LweI	GCATC	1 cut(s)	54
MaeII	ACGT	1 cut(s)	81
MaeIII	GTNAC	1 cut(s)	82
MalI	GATC	3 cut(s)	5, 12, 93
MboI	GATC	3 cut(s)	3, 10, 91
MboII	GAAGA	2 cut(s)	40, 46
MluCI	AATT	1 cut(s)	66
NdeII	GATC	3 cut(s)	3, 10, 91
Ppu21I	YACGTR	1 cut(s)	82
Sau3AI	GATC	3 cut(s)	3, 10, 91
SetI	ASST	1 cut(s)	84
SfaNI	GCATC	1 cut(s)	54
SgeI	CNNG	3 cut(s)	26, 31, 53
SnaBI	TACGTA	1 cut(s)	82
Sse9I	AATT	1 cut(s)	66
TaiI	ACGT	1 cut(s)	84
TaqI	TCGA	1 cut(s)	6
TasI	AATT	1 cut(s)	66
TspDTI	ATGAA	1 cut(s)	40

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.