Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr07

Orthogroup ID

OG0017901

Physical Location & Seq

Genomic Coordinates Forward (+)

27427976 .. 27428230

Gene Structure 255 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD07G1195400.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 168 bp

ATGATATTTTGTAGTGTAATACTAATTCATGTCATTCTGTTTGTCTTCCAACAGATGATTGATGATGTAGGGCTGGGGACTGTTGCCAACTTACTTGGCATGTTCATATTTTTTCTAGTGATTGCTTATCATTACGTTACGGCCGACCCAAAATACGAGGGCAACTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Ost4

Protein Analysis

56

Amino Acids

6.24

Weight (kDa)

4.63

Isoelectric Point (pI)

23.71

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Ost4	PF10215	19 - 51	3.2e-12	Oligosaccaryltransferase

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017901)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G12587
malus_domestica	MD01G1125600.v1.1 MD07G1195100.v1.1 MD07G1195400.v1.1
prunus_persica	Prupe.2G232600_v2.0.a1 Prupe.2G232600_v2.0.a1
rosa_chinensis	RchiOBHm_Chr1g0366451
rosa_multiflora	Rmu_ssc0000250.1_g000017
rosa_roxburghii	Rroxscaffold_4G00289930 Rroxscaffold_4G00290190
rosa_samantha	Rh1DG331100

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcoI	YGGCCR	1 cut(s)	141
AoxI	GGCC	1 cut(s)	141
BbsI	GAAGAC	1 cut(s)	37
BceAI	ACGGC	1 cut(s)	156
BfaI	CTAG	1 cut(s)	116
BpiI	GAAGAC	1 cut(s)	37
BseX3I	CGGCCG	1 cut(s)	141
BseYI	CCCAGC	1 cut(s)	73
Bsh1285I	CGRYCG	1 cut(s)	144
BshFI	GGCC	1 cut(s)	143
BsiEI	CGRYCG	1 cut(s)	144
BslFI	GGGAC	1 cut(s)	91
BsmFI	GGGAC	1 cut(s)	91
BsnI	GGCC	1 cut(s)	143
BspANI	GGCC	1 cut(s)	143
Bst4CI	ACNGT	1 cut(s)	82
BstMCI	CGRYCG	1 cut(s)	144
BstNSI	RCATGY	1 cut(s)	103
BstV2I	GAAGAC	1 cut(s)	37
BstZI	CGGCCG	1 cut(s)	141
BsuRI	GGCC	1 cut(s)	143
CviAII	CATG	2 cut(s)	29, 100
CviJI	RGCY	2 cut(s)	73, 143
CviKI_1	RGCY	2 cut(s)	73, 143
EaeI	YGGCCR	1 cut(s)	141
EagI	CGGCCG	1 cut(s)	141
EclXI	CGGCCG	1 cut(s)	141
Eco52I	CGGCCG	1 cut(s)	141
FaeI	CATG	2 cut(s)	32, 103
FaiI	YATR	3 cut(s)	30, 101, 107
FaqI	GGGAC	1 cut(s)	91
FatI	CATG	2 cut(s)	28, 99
FspBI	CTAG	1 cut(s)	116
GsaI	CCCAGC	1 cut(s)	77
HaeIII	GGCC	1 cut(s)	143
Hin1II	CATG	2 cut(s)	32, 103
HpyCH4III	ACNGT	1 cut(s)	82
HpyCH4IV	ACGT	1 cut(s)	135
HpySE526I	ACGT	1 cut(s)	135
Hsp92II	CATG	2 cut(s)	32, 103
LpnPI	CCDG	1 cut(s)	59
MaeI	CTAG	1 cut(s)	116
MaeII	ACGT	1 cut(s)	135
MaeIII	GTNAC	1 cut(s)	136
MboII	GAAGA	1 cut(s)	37
MluCI	AATT	1 cut(s)	24
MmeI	TCCRAC	1 cut(s)	73
MnlI	CCTC	1 cut(s)	151
NlaIII	CATG	2 cut(s)	32, 103
NspI	RCATGY	1 cut(s)	103
PcsI	WCGNNNNNNNCGW	1 cut(s)	141
PspFI	CCCAGC	1 cut(s)	73
SetI	ASST	1 cut(s)	138
SgeI	CNNG	5 cut(s)	41, 86, 107, 112, 128
Sse9I	AATT	1 cut(s)	24
SspMI	CTAG	1 cut(s)	116
TaaI	ACNGT	1 cut(s)	82
TaiI	ACGT	1 cut(s)	138
TasI	AATT	1 cut(s)	24
TspDTI	ATGAA	2 cut(s)	17, 94
XceI	RCATGY	1 cut(s)	103
XspI	CTAG	1 cut(s)	116

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.