RchiOBHm_Chr1g0366451

Dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit 4A

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
56975563 .. 56976288
726 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ59098

Sequence Viewer

Length: 171 bp
ATGAATGCAATAGACTGTGCTTCTAGCCTGAAAATGTTCATTTGCAGAAATGCTGTGATGATTGATGATCACCAACTGGGCATAATAGCCAATGTTCTTGGCATGTTCATATTTCTCCTGGTGATTGCTTATCATTACGTGACGGCAGACCCAAAATATGAAGGCCACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

56

Amino Acids

6.29

Weight (kDa)

5.73

Isoelectric Point (pI)

23.92

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ost4 PF10215 20 - 52 9.6e-15 Oligosaccaryltransferase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017901)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AjnI CCWGG 1 cut(s) 117
AoxI GGCC 1 cut(s) 163
Asp700I GAANNNNTTC 1 cut(s) 35
AsuHPI GGTGA 2 cut(s) 62, 133
BceAI ACGGC 1 cut(s) 159
BciT130I CCWGG 1 cut(s) 119
BclI TGATCA 1 cut(s) 67
BfaI CTAG 1 cut(s) 24
Bme1390I CCNGG 1 cut(s) 119
BmrFI CCNGG 1 cut(s) 119
BmrI ACTGGG 1 cut(s) 86
BmuI ACTGGG 1 cut(s) 86
BsaAI YACGTR 1 cut(s) 139
Bse1I ACTGG 1 cut(s) 81
BseBI CCWGG 1 cut(s) 119
BseNI ACTGG 1 cut(s) 81
BshFI GGCC 1 cut(s) 165
BsmI GAATGC 1 cut(s) 10
BsnI GGCC 1 cut(s) 165
Bsp143I GATC 1 cut(s) 67
BspANI GGCC 1 cut(s) 165
BsrI ACTGG 1 cut(s) 81
BssMI GATC 1 cut(s) 67
Bst2UI CCWGG 1 cut(s) 119
Bst4CI ACNGT 1 cut(s) 17
BstBAI YACGTR 1 cut(s) 139
BstKTI GATC 1 cut(s) 70
BstMBI GATC 1 cut(s) 67
BstNI CCWGG 1 cut(s) 119
BstNSI RCATGY 1 cut(s) 106
BstSCI CCNGG 1 cut(s) 117
BsuRI GGCC 1 cut(s) 165
BtsIMutI CAGTG 1 cut(s) 166
CviAII CATG 1 cut(s) 103
CviJI RGCY 3 cut(s) 27, 89, 165
CviKI_1 RGCY 3 cut(s) 27, 89, 165
DpnI GATC 1 cut(s) 69
DpnII GATC 1 cut(s) 67
EcoRII CCWGG 1 cut(s) 117
FaeI CATG 1 cut(s) 106
FaiI YATR 4 cut(s) 83, 104, 110, 159
FatI CATG 1 cut(s) 102
FbaI TGATCA 1 cut(s) 67
FspBI CTAG 1 cut(s) 24
HaeIII GGCC 1 cut(s) 165
Hin1II CATG 1 cut(s) 106
HphI GGTGA 2 cut(s) 62, 133
HpyAV CCTTC 1 cut(s) 155
HpyCH4III ACNGT 1 cut(s) 17
HpyCH4IV ACGT 1 cut(s) 138
HpyCH4V TGCA 2 cut(s) 8, 45
HpySE526I ACGT 1 cut(s) 138
Hsp92II CATG 1 cut(s) 106
Ksp22I TGATCA 1 cut(s) 67
Kzo9I GATC 1 cut(s) 67
LpnPI CCDG 4 cut(s) 41, 62, 104, 131
MaeI CTAG 1 cut(s) 24
MaeII ACGT 1 cut(s) 138
MaeIII GTNAC 1 cut(s) 139
MalI GATC 1 cut(s) 69
MboI GATC 1 cut(s) 67
MroXI GAANNNNTTC 1 cut(s) 35
MspR9I CCNGG 1 cut(s) 119
Mva1269I GAATGC 1 cut(s) 10
MvaI CCWGG 1 cut(s) 119
NdeII GATC 1 cut(s) 67
NlaIII CATG 1 cut(s) 106
NmuCI GTSAC 1 cut(s) 139
NspI RCATGY 1 cut(s) 106
PctI GAATGC 1 cut(s) 10
PdmI GAANNNNTTC 1 cut(s) 35
Ppu21I YACGTR 1 cut(s) 139
Psp6I CCWGG 1 cut(s) 117
PspGI CCWGG 1 cut(s) 117
Sau3AI GATC 1 cut(s) 67
ScrFI CCNGG 1 cut(s) 119
SetI ASST 1 cut(s) 141
SgeI CNNG 8 cut(s) 36, 40, 89, 110, 115, 130, 131, 151
SspMI CTAG 1 cut(s) 24
StyD4I CCNGG 1 cut(s) 117
TaaI ACNGT 1 cut(s) 17
TaiI ACGT 1 cut(s) 141
TseFI GTSAC 1 cut(s) 139
Tsp45I GTSAC 1 cut(s) 139
TspDTI ATGAA 3 cut(s) 17, 28, 97
XceI RCATGY 1 cut(s) 106
XmnI GAANNNNTTC 1 cut(s) 35
XspI CTAG 1 cut(s) 24
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.