Prupe.2G232600_v2.0.a1

Dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit 4A

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp02
Physical Location & Seq
Forward (+)
25616448 .. 25618984
2537 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.2G232600.1

Sequence Viewer

Length: 330 bp
ATGCTCTGGTTGGTGCATAAGTCCGTATTTAAATGGGCCAACAATTCGGGCCATAAGTTGACTTTTTTTGGTGTTTCGGGTCGGAGCGAGAAGGTGAATAAAAAGGCGGTTTGTTTTCCGCTCCACCTACGTATCTCGGTTACATTTCAAAGTTGGGTCCTGCCATTGACGATCTGTTCGCAGCTTCAGGTGTCTTCGCATTTTATCTTCACGAAGATGATTGACGATCAAGGCCTGGGGATTGTTGCCAACCTTCTTGGCATCTTCATATTTGTTCTGGTGATTGCCTATCATTATGTGACGGCAGACCCAAAATATGAGGGCAACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

110

Amino Acids

12.36

Weight (kDa)

9.47

Isoelectric Point (pI)

38.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017901)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 121
AciI CCGC 2 cut(s) 107, 119
AcuI CTGAAG 1 cut(s) 170
AgsI TTSAA 1 cut(s) 149
AjnI CCWGG 1 cut(s) 234
AluBI AGCT 1 cut(s) 184
AluI AGCT 1 cut(s) 184
AoxI GGCC 3 cut(s) 36, 49, 232
ApeKI GCWGC 1 cut(s) 181
ArsI GACNNNNNNTTYG 2 cut(s) 160, 192
AspS9I GGNCC 3 cut(s) 36, 49, 157
AsuHPI GGTGA 2 cut(s) 106, 292
AvaII GGWCC 1 cut(s) 157
BaeI ACNNNNGTAYC 2 cut(s) 115, 148
BbsI GAAGAC 1 cut(s) 186
BbvI GCAGC 1 cut(s) 193
BceAI ACGGC 1 cut(s) 318
BciT130I CCWGG 1 cut(s) 236
BisI GCNGC 1 cut(s) 182
BlsI GCNGC 1 cut(s) 183
Bme1390I CCNGG 1 cut(s) 236
Bme18I GGWCC 1 cut(s) 157
BmgT120I GGNCC 3 cut(s) 36, 49, 157
BmiI GGNNCC 1 cut(s) 158
BmrFI CCNGG 1 cut(s) 236
BmsI GCATC 1 cut(s) 270
BpiI GAAGAC 1 cut(s) 186
BsaAI YACGTR 1 cut(s) 131
BsaJI CCNNGG 1 cut(s) 235
BseBI CCWGG 1 cut(s) 236
BseDI CCNNGG 1 cut(s) 235
BseXI GCAGC 1 cut(s) 193
BshFI GGCC 3 cut(s) 38, 51, 234
BsnI GGCC 3 cut(s) 38, 51, 234
Bsp143I GATC 2 cut(s) 171, 226
BspACI CCGC 2 cut(s) 107, 119
BspANI GGCC 3 cut(s) 38, 51, 234
BspLI GGNNCC 1 cut(s) 158
BsrBI CCGCTC 1 cut(s) 121
BssECI CCNNGG 1 cut(s) 235
BssMI GATC 2 cut(s) 171, 226
Bst2UI CCWGG 1 cut(s) 236
BstBAI YACGTR 1 cut(s) 131
BstKTI GATC 2 cut(s) 174, 229
BstMBI GATC 2 cut(s) 171, 226
BstNI CCWGG 1 cut(s) 236
BstSCI CCNGG 1 cut(s) 234
BstSNI TACGTA 1 cut(s) 131
BstV1I GCAGC 1 cut(s) 193
BstV2I GAAGAC 1 cut(s) 186
BsuRI GGCC 3 cut(s) 38, 51, 234
Cfr13I GGNCC 3 cut(s) 36, 49, 157
CviJI RGCY 4 cut(s) 38, 51, 184, 234
CviKI_1 RGCY 4 cut(s) 38, 51, 184, 234
DpnI GATC 2 cut(s) 173, 228
DpnII GATC 2 cut(s) 171, 226
DraI TTTAAA 1 cut(s) 31
Eco105I TACGTA 1 cut(s) 131
Eco147I AGGCCT 1 cut(s) 234
Eco47I GGWCC 1 cut(s) 157
Eco57I CTGAAG 1 cut(s) 170
EcoO109I RGGNCCY 1 cut(s) 157
EcoRII CCWGG 1 cut(s) 234
FaiI YATR 5 cut(s) 18, 54, 269, 297, 318
Fnu4HI GCNGC 1 cut(s) 182
Fsp4HI GCNGC 1 cut(s) 182
GluI GCNGC 1 cut(s) 182
HaeIII GGCC 3 cut(s) 38, 51, 234
HincII GTYRAC 1 cut(s) 60
HindII GTYRAC 1 cut(s) 60
HphI GGTGA 2 cut(s) 106, 292
Hpy166II GTNNAC 1 cut(s) 60
Hpy188I TCNGA 1 cut(s) 84
Hpy188III TCNNGA 1 cut(s) 211
Hpy8I GTNNAC 1 cut(s) 60
HpyAV CCTTC 2 cut(s) 85, 263
HpyCH4IV ACGT 1 cut(s) 130
HpyCH4V TGCA 1 cut(s) 16
HpySE526I ACGT 1 cut(s) 130
Kzo9I GATC 2 cut(s) 171, 226
LmnI GCTCC 2 cut(s) 84, 126
LpnPI CCDG 5 cut(s) 173, 173, 221, 248, 263
Lsp1109I GCAGC 1 cut(s) 193
LweI GCATC 1 cut(s) 270
MaeII ACGT 1 cut(s) 130
MaeIII GTNAC 2 cut(s) 139, 298
MalI GATC 2 cut(s) 173, 228
MbiI CCGCTC 1 cut(s) 121
MboI GATC 2 cut(s) 171, 226
MboII GAAGA 4 cut(s) 186, 199, 226, 256
MluCI AATT 1 cut(s) 43
MmeI TCCRAC 1 cut(s) 62
MnlI CCTC 1 cut(s) 313
MseI TTAA 1 cut(s) 30
MslI CAYNNNNRTG 1 cut(s) 215
MspR9I CCNGG 1 cut(s) 236
MvaI CCWGG 1 cut(s) 236
NdeII GATC 2 cut(s) 171, 226
NlaIV GGNNCC 1 cut(s) 158
NmuCI GTSAC 1 cut(s) 298
PceI AGGCCT 1 cut(s) 234
PkrI GCNGC 1 cut(s) 183
Ppu21I YACGTR 1 cut(s) 131
PpuMI RGGWCCY 1 cut(s) 157
Psp5II RGGWCCY 1 cut(s) 157
Psp6I CCWGG 1 cut(s) 234
PspGI CCWGG 1 cut(s) 234
PspN4I GGNNCC 1 cut(s) 158
PspPI GGNCC 3 cut(s) 36, 49, 157
PspPPI RGGWCCY 1 cut(s) 157
RseI CAYNNNNRTG 1 cut(s) 215
SaqAI TTAA 1 cut(s) 30
SatI GCNGC 1 cut(s) 182
Sau3AI GATC 2 cut(s) 171, 226
Sau96I GGNCC 3 cut(s) 36, 49, 157
ScrFI CCNGG 1 cut(s) 236
SetI ASST 6 cut(s) 96, 129, 133, 186, 192, 255
SfaNI GCATC 1 cut(s) 270
SinI GGWCC 1 cut(s) 157
SmiI ATTTAAAT 1 cut(s) 31
SmiMI CAYNNNNRTG 1 cut(s) 215
SnaBI TACGTA 1 cut(s) 131
Sse9I AATT 1 cut(s) 43
SseBI AGGCCT 1 cut(s) 234
SsiI CCGC 2 cut(s) 107, 119
StuI AGGCCT 1 cut(s) 234
StyD4I CCNGG 1 cut(s) 234
SwaI ATTTAAAT 1 cut(s) 31
TaiI ACGT 1 cut(s) 133
TasI AATT 1 cut(s) 43
Tru1I TTAA 1 cut(s) 30
Tru9I TTAA 1 cut(s) 30
TseFI GTSAC 1 cut(s) 298
TseI GCWGC 1 cut(s) 181
Tsp45I GTSAC 1 cut(s) 298
TspDTI ATGAA 1 cut(s) 256
TspGWI ACGGA 1 cut(s) 13
VpaK11BI GGWCC 1 cut(s) 157
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.