MD01G1125600.v1.1

Dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr01
OG0017901
Physical Location & Seq
Forward (+)
23781899 .. 23783172
1274 bp
Loading structure...
UTR
Exon/CDS
Intron
MD01G1125600.v1.1.491

Sequence Viewer

Length: 132 bp
ATGCATTTCCCAATTTCTATGATTGACGATGAAGGCCTGGAGATTTATGCCAACTTACTTGGCATGTTCATATTTTTTCTACTCATTGTTTATCATTACGTGACGGCCAACCCGAACTACGAGGGCAACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Ost4

Protein Analysis

44

Amino Acids

5.03

Weight (kDa)

4.17

Isoelectric Point (pI)

38.13

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ost4 PF10215 7 - 38 1.5e-10 Oligosaccaryltransferase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017901)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G12587
malus_domestica MD01G1125600.v1.1 MD07G1195100.v1.1 MD07G1195400.v1.1
prunus_persica Prupe.2G232600_v2.0.a1 Prupe.2G232600_v2.0.a1
rosa_chinensis RchiOBHm_Chr1g0366451
rosa_multiflora Rmu_ssc0000250.1_g000017
rosa_roxburghii Rroxscaffold_4G00289930 Rroxscaffold_4G00290190
rosa_samantha Rh1DG331100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 105
AjnI CCWGG 1 cut(s) 36
AoxI GGCC 2 cut(s) 34, 105
BceAI ACGGC 1 cut(s) 120
BciT130I CCWGG 1 cut(s) 38
Bme1390I CCNGG 1 cut(s) 38
BmrFI CCNGG 1 cut(s) 38
BpmI CTGGAG 1 cut(s) 59
BsaAI YACGTR 1 cut(s) 100
BseBI CCWGG 1 cut(s) 38
BshFI GGCC 2 cut(s) 36, 107
BsnI GGCC 2 cut(s) 36, 107
BspANI GGCC 2 cut(s) 36, 107
Bst2UI CCWGG 1 cut(s) 38
BstBAI YACGTR 1 cut(s) 100
BstNI CCWGG 1 cut(s) 38
BstNSI RCATGY 1 cut(s) 67
BstSCI CCNGG 1 cut(s) 36
BsuRI GGCC 2 cut(s) 36, 107
CviAII CATG 1 cut(s) 64
CviJI RGCY 2 cut(s) 36, 107
CviKI_1 RGCY 2 cut(s) 36, 107
EaeI YGGCCR 1 cut(s) 105
Eco147I AGGCCT 1 cut(s) 36
EcoRII CCWGG 1 cut(s) 36
EcoT22I ATGCAT 1 cut(s) 6
FaeI CATG 1 cut(s) 67
FaiI YATR 4 cut(s) 20, 48, 65, 71
FatI CATG 1 cut(s) 63
GsuI CTGGAG 1 cut(s) 59
HaeIII GGCC 2 cut(s) 36, 107
Hin1II CATG 1 cut(s) 67
HpyAV CCTTC 1 cut(s) 26
HpyCH4IV ACGT 1 cut(s) 99
HpyCH4V TGCA 1 cut(s) 4
HpySE526I ACGT 1 cut(s) 99
Hsp92II CATG 1 cut(s) 67
LpnPI CCDG 2 cut(s) 23, 50
MaeII ACGT 1 cut(s) 99
MaeIII GTNAC 1 cut(s) 100
MluCI AATT 1 cut(s) 12
MnlI CCTC 1 cut(s) 115
Mph1103I ATGCAT 1 cut(s) 6
MspR9I CCNGG 1 cut(s) 38
MvaI CCWGG 1 cut(s) 38
NlaIII CATG 1 cut(s) 67
NmuCI GTSAC 1 cut(s) 100
NsiI ATGCAT 1 cut(s) 6
NspI RCATGY 1 cut(s) 67
PceI AGGCCT 1 cut(s) 36
PcsI WCGNNNNNNNCGW 1 cut(s) 110
Ppu21I YACGTR 1 cut(s) 100
Psp6I CCWGG 1 cut(s) 36
PspGI CCWGG 1 cut(s) 36
ScrFI CCNGG 1 cut(s) 38
SetI ASST 1 cut(s) 102
SgeI CNNG 6 cut(s) 49, 50, 71, 76, 112, 124
Sse9I AATT 1 cut(s) 12
SseBI AGGCCT 1 cut(s) 36
StuI AGGCCT 1 cut(s) 36
StyD4I CCNGG 1 cut(s) 36
TaiI ACGT 1 cut(s) 102
TasI AATT 1 cut(s) 12
TseFI GTSAC 1 cut(s) 100
Tsp45I GTSAC 1 cut(s) 100
TspDTI ATGAA 2 cut(s) 45, 58
XceI RCATGY 1 cut(s) 67
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.