AT3G19660

No description available

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
3
Physical Location & Seq
Reverse (-)
6825433 .. 6826585
1153 bp
Loading structure...
UTR
Exon/CDS
Intron
AT3G19660.1

Sequence Viewer

Length: 195 bp
ATGGGATTACAGTTGGAGAGTTTGATGGAGACGATAAAGTCAAAGGTGAGTTTGCTAAGGAAGAAGAAGAAAACTTACATCAAAATGGACAAAAGCTCCAGCGTCAGAGTCGCCATCCGTCGTAAGAAGACTAGAGATCTCATCGATAAGACCTTAAAGGTCGCTGATCGTCCTGGCAAACGAACTCTTTTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

64

Amino Acids

7.46

Weight (kDa)

10.91

Isoelectric Point (pI)

36.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 37
AjnI CCWGG 1 cut(s) 172
AluBI AGCT 1 cut(s) 96
AluI AGCT 1 cut(s) 96
Alw26I GTCTC 1 cut(s) 23
AsuHPI GGTGA 1 cut(s) 58
BarI GAAGNNNNNNTAC 2 cut(s) 59, 91
BbsI GAAGAC 1 cut(s) 134
BccI CCATC 2 cut(s) 19, 122
BciT130I CCWGG 1 cut(s) 174
BcoDI GTCTC 1 cut(s) 23
BfaI CTAG 1 cut(s) 132
BglII AGATCT 1 cut(s) 136
Bme1390I CCNGG 1 cut(s) 174
BmrFI CCNGG 1 cut(s) 174
BpiI GAAGAC 1 cut(s) 134
BpmI CTGGAG 1 cut(s) 82
Bpu10I CCTNAGC 1 cut(s) 56
Bsa29I ATCGAT 1 cut(s) 144
BsaXI ACNNNNNCTCC 2 cut(s) 80, 110
BseBI CCWGG 1 cut(s) 174
BseCI ATCGAT 1 cut(s) 144
BseGI GGATG 1 cut(s) 114
BshVI ATCGAT 1 cut(s) 144
BsmAI GTCTC 1 cut(s) 23
BsmBI CGTCTC 1 cut(s) 23
Bsp143I GATC 2 cut(s) 136, 166
BspDI ATCGAT 1 cut(s) 144
BssMI GATC 2 cut(s) 136, 166
Bst2UI CCWGG 1 cut(s) 174
Bst4CI ACNGT 1 cut(s) 12
BstDEI CTNAG 1 cut(s) 56
BstF5I GGATG 1 cut(s) 114
BstKTI GATC 2 cut(s) 139, 169
BstMAI GTCTC 1 cut(s) 23
BstMBI GATC 2 cut(s) 136, 166
BstNI CCWGG 1 cut(s) 174
BstSCI CCNGG 1 cut(s) 172
BstV2I GAAGAC 1 cut(s) 134
BstX2I RGATCY 1 cut(s) 136
BstYI RGATCY 1 cut(s) 136
Bsu15I ATCGAT 1 cut(s) 144
BsuTUI ATCGAT 1 cut(s) 144
BtsCI GGATG 1 cut(s) 114
ClaI ATCGAT 1 cut(s) 144
CseI GACGC 1 cut(s) 91
CviJI RGCY 1 cut(s) 96
CviKI_1 RGCY 1 cut(s) 96
DdeI CTNAG 1 cut(s) 56
DpnI GATC 2 cut(s) 138, 168
DpnII GATC 2 cut(s) 136, 166
DrdI GACNNNNNNGTC 1 cut(s) 37
DseDI GACNNNNNNGTC 1 cut(s) 37
EcoRII CCWGG 1 cut(s) 172
Esp3I CGTCTC 1 cut(s) 23
FokI GGATG 1 cut(s) 101
FspBI CTAG 1 cut(s) 132
GsuI CTGGAG 1 cut(s) 82
HgaI GACGC 1 cut(s) 91
HinfI GANTC 1 cut(s) 108
HphI GGTGA 1 cut(s) 58
Hpy188I TCNGA 1 cut(s) 107
Hpy99I CGWCG 1 cut(s) 123
HpyCH4III ACNGT 1 cut(s) 12
HpyF3I CTNAG 1 cut(s) 56
Kzo9I GATC 2 cut(s) 136, 166
LmnI GCTCC 1 cut(s) 101
LpnPI CCDG 3 cut(s) 112, 159, 186
MaeI CTAG 1 cut(s) 132
MalI GATC 2 cut(s) 138, 168
MboI GATC 2 cut(s) 136, 166
MboII GAAGA 4 cut(s) 73, 76, 79, 139
MflI RGATCY 1 cut(s) 136
MlyI GAGTC 1 cut(s) 117
MseI TTAA 1 cut(s) 155
MslI CAYNNNNRTG 1 cut(s) 83
MspR9I CCNGG 1 cut(s) 174
MvaI CCWGG 1 cut(s) 174
NdeII GATC 2 cut(s) 136, 166
PleI GAGTC 1 cut(s) 116
PpsI GAGTC 1 cut(s) 116
Psp6I CCWGG 1 cut(s) 172
PspGI CCWGG 1 cut(s) 172
PsuI RGATCY 1 cut(s) 136
RseI CAYNNNNRTG 1 cut(s) 83
SaqAI TTAA 1 cut(s) 155
Sau3AI GATC 2 cut(s) 136, 166
SchI GAGTC 1 cut(s) 117
ScrFI CCNGG 1 cut(s) 174
SetI ASST 4 cut(s) 48, 98, 155, 162
SgeI CNNG 4 cut(s) 111, 144, 185, 186
SmiMI CAYNNNNRTG 1 cut(s) 83
SspMI CTAG 1 cut(s) 132
StyD4I CCNGG 1 cut(s) 172
TaaI ACNGT 1 cut(s) 12
TaqI TCGA 1 cut(s) 144
Tru1I TTAA 1 cut(s) 155
Tru9I TTAA 1 cut(s) 155
TspGWI ACGGA 1 cut(s) 107
XspI CTAG 1 cut(s) 132
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.