RchiOBHm_Chr2g0163791

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
79115395 .. 79116089
695 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ53192

Sequence Viewer

Length: 207 bp
ATGGTGATGATGGGGTTGGATAGGTTGGTGGGGAATTTGAAGTCCAAGTTCAGGTCCTTTAAGATGAAGAAACCAGCTGCAGATTACAACAAGATCGAAAAGAGCGATAGCATGAGAGTCGAAATAAGAAGCAAGAAGGCCAGAAAGCTCATTGAGAAGACACTGAAAGTTGCAGACTCTCCCAAGATGAAAACGTTCGCTTTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

68

Amino Acids

7.9

Weight (kDa)

10.42

Isoelectric Point (pI)

51.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 194
AcsI RAATTY 1 cut(s) 34
AfiI CCNNNNNNNGG 1 cut(s) 51
AgsI TTSAA 1 cut(s) 40
AluBI AGCT 2 cut(s) 77, 148
AluI AGCT 2 cut(s) 77, 148
AoxI GGCC 1 cut(s) 138
ApeKI GCWGC 1 cut(s) 77
ApoI RAATTY 1 cut(s) 34
Asp700I GAANNNNTTC 1 cut(s) 194
AspS9I GGNCC 1 cut(s) 54
AsuHPI GGTGA 1 cut(s) 16
AvaII GGWCC 1 cut(s) 54
BbsI GAAGAC 1 cut(s) 164
BbvI GCAGC 1 cut(s) 64
BccI CCATC 1 cut(s) 4
BcgI CGANNNNNNTGC 2 cut(s) 100, 134
BfmI CTRYAG 1 cut(s) 78
BisI GCNGC 1 cut(s) 78
BlsI GCNGC 1 cut(s) 79
Bme18I GGWCC 1 cut(s) 54
BmgT120I GGNCC 1 cut(s) 54
BpiI GAAGAC 1 cut(s) 164
Bsc4I CCNNNNNNNGG 1 cut(s) 51
BseLI CCNNNNNNNGG 1 cut(s) 51
BseXI GCAGC 1 cut(s) 64
BshFI GGCC 1 cut(s) 140
BslI CCNNNNNNNGG 1 cut(s) 51
BsnI GGCC 1 cut(s) 140
Bsp143I GATC 1 cut(s) 93
BspANI GGCC 1 cut(s) 140
BspMAI CTGCAG 1 cut(s) 82
BssMI GATC 1 cut(s) 93
BstKTI GATC 1 cut(s) 96
BstMBI GATC 1 cut(s) 93
BstSFI CTRYAG 1 cut(s) 78
BstV1I GCAGC 1 cut(s) 64
BstV2I GAAGAC 1 cut(s) 164
BsuRI GGCC 1 cut(s) 140
BtsIMutI CAGTG 1 cut(s) 161
Cfr13I GGNCC 1 cut(s) 54
CviAII CATG 1 cut(s) 112
CviJI RGCY 3 cut(s) 77, 140, 148
CviKI_1 RGCY 3 cut(s) 77, 140, 148
DpnI GATC 1 cut(s) 95
DpnII GATC 1 cut(s) 93
Eco47I GGWCC 1 cut(s) 54
EcoO109I RGGNCCY 1 cut(s) 54
FaeI CATG 1 cut(s) 115
FaiI YATR 1 cut(s) 113
FatI CATG 1 cut(s) 111
Fnu4HI GCNGC 1 cut(s) 78
Fsp4HI GCNGC 1 cut(s) 78
GluI GCNGC 1 cut(s) 78
HaeIII GGCC 1 cut(s) 140
Hin1II CATG 1 cut(s) 115
HinfI GANTC 2 cut(s) 117, 176
HphI GGTGA 1 cut(s) 16
HpyAV CCTTC 1 cut(s) 130
HpyCH4IV ACGT 1 cut(s) 194
HpyCH4V TGCA 2 cut(s) 80, 173
HpySE526I ACGT 1 cut(s) 194
Hsp92II CATG 1 cut(s) 115
Kzo9I GATC 1 cut(s) 93
LpnPI CCDG 3 cut(s) 37, 87, 154
Lsp1109I GCAGC 1 cut(s) 64
MaeII ACGT 1 cut(s) 194
MalI GATC 1 cut(s) 95
MboI GATC 1 cut(s) 93
MboII GAAGA 2 cut(s) 79, 169
MluCI AATT 1 cut(s) 34
MlyI GAGTC 2 cut(s) 126, 170
MroXI GAANNNNTTC 1 cut(s) 194
MseI TTAA 1 cut(s) 60
MspA1I CMGCKG 1 cut(s) 77
NdeII GATC 1 cut(s) 93
NlaIII CATG 1 cut(s) 115
PcsI WCGNNNNNNNCGW 1 cut(s) 102
PdmI GAANNNNTTC 1 cut(s) 194
PkrI GCNGC 1 cut(s) 79
PleI GAGTC 2 cut(s) 125, 170
PpsI GAGTC 2 cut(s) 125, 170
PpuMI RGGWCCY 1 cut(s) 54
Psp1406I AACGTT 1 cut(s) 194
Psp5II RGGWCCY 1 cut(s) 54
PspPI GGNCC 1 cut(s) 54
PspPPI RGGWCCY 1 cut(s) 54
PstI CTGCAG 1 cut(s) 82
PvuII CAGCTG 1 cut(s) 77
SaqAI TTAA 1 cut(s) 60
SatI GCNGC 1 cut(s) 78
Sau3AI GATC 1 cut(s) 93
Sau96I GGNCC 1 cut(s) 54
SchI GAGTC 2 cut(s) 126, 170
SetI ASST 5 cut(s) 26, 56, 79, 150, 197
SfcI CTRYAG 1 cut(s) 78
SgeI CNNG 8 cut(s) 58, 64, 86, 103, 124, 145, 153, 196
SinI GGWCC 1 cut(s) 54
Sse9I AATT 1 cut(s) 34
TaiI ACGT 1 cut(s) 197
TaqI TCGA 2 cut(s) 96, 120
TasI AATT 1 cut(s) 34
Tru1I TTAA 1 cut(s) 60
Tru9I TTAA 1 cut(s) 60
TscAI CASTG 1 cut(s) 168
TseI GCWGC 1 cut(s) 77
TspDTI ATGAA 2 cut(s) 80, 203
TspRI CASTG 1 cut(s) 168
VpaK11BI GGWCC 1 cut(s) 54
XapI RAATTY 1 cut(s) 34
XmnI GAANNNNTTC 1 cut(s) 194
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.