Prupe.3G242600_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp03
Physical Location & Seq
Forward (+)
23563900 .. 23565163
1264 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.3G242600.1

Sequence Viewer

Length: 201 bp
ATGATGATGCTGGGATTGGAGAGGTTGGTGTTGAATTTGAAATCCAAGTTGAGGTCTTTGAAGGTGAACAAGAAGCCTTATGACAAGATTGAAAAGAGTGAGAGCATGAGAGTTGAAATAAGGAGCAAGAAGGCCAGAAAGCTCATTGAAAAGACTTTGAAAGTAGCAGATTCTCCCAAGTCCAAAACCTTCGCTTTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

67

Amino Acids

7.71

Weight (kDa)

10.42

Isoelectric Point (pI)

50.75

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 34
AfiI CCNNNNNNNGG 1 cut(s) 51
AgsI TTSAA 7 cut(s) 34, 40, 61, 92, 116, 149, 160
AluBI AGCT 1 cut(s) 142
AluI AGCT 1 cut(s) 142
AoxI GGCC 1 cut(s) 132
ApoI RAATTY 1 cut(s) 34
AsuHPI GGTGA 1 cut(s) 76
Bsc4I CCNNNNNNNGG 1 cut(s) 51
BseLI CCNNNNNNNGG 1 cut(s) 51
BseYI CCCAGC 1 cut(s) 10
BshFI GGCC 1 cut(s) 134
BslI CCNNNNNNNGG 1 cut(s) 51
BsnI GGCC 1 cut(s) 134
BspANI GGCC 1 cut(s) 134
BsuRI GGCC 1 cut(s) 134
CviAII CATG 1 cut(s) 106
CviJI RGCY 3 cut(s) 76, 134, 142
CviKI_1 RGCY 3 cut(s) 76, 134, 142
FaeI CATG 1 cut(s) 109
FaiI YATR 2 cut(s) 81, 107
FatI CATG 1 cut(s) 105
GsaI CCCAGC 1 cut(s) 14
HaeIII GGCC 1 cut(s) 134
Hin1II CATG 1 cut(s) 109
HinfI GANTC 1 cut(s) 170
HphI GGTGA 1 cut(s) 76
Hpy166II GTNNAC 1 cut(s) 67
Hpy8I GTNNAC 1 cut(s) 67
HpyAV CCTTC 3 cut(s) 55, 124, 199
Hsp92II CATG 1 cut(s) 109
LmnI GCTCC 1 cut(s) 123
LpnPI CCDG 1 cut(s) 148
MluCI AATT 1 cut(s) 34
MnlI CCTC 2 cut(s) 15, 45
NlaIII CATG 1 cut(s) 109
PfeI GAWTC 1 cut(s) 170
PspFI CCCAGC 1 cut(s) 10
SetI ASST 5 cut(s) 26, 56, 66, 144, 191
SgeI CNNG 8 cut(s) 23, 58, 82, 97, 118, 139, 147, 190
Sse9I AATT 1 cut(s) 34
TasI AATT 1 cut(s) 34
TfiI GAWTC 1 cut(s) 170
XapI RAATTY 1 cut(s) 34
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.