AT3G57062

No description available

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
3
Physical Location & Seq
Forward (+)
21121323 .. 21122569
1247 bp
Loading structure...
UTR
Exon/CDS
Intron
AT3G57062.2

Sequence Viewer

Length: 147 bp
ATGGCGATGCCGCTGGGCATGGCGATGTATCTGATGAGAATGGTTTGGTTTTCTCTGAGTGGTTGGGTTTTCACTTGCGTGGCTATCGCTGATGAGATCGCTGGTTCTCTGAGAAACGGAGATATTGGTCCTTTCCACGTCGGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

48

Amino Acids

5.25

Weight (kDa)

5.36

Isoelectric Point (pI)

34.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 11
AjiI CACGTC 1 cut(s) 139
AleI CACNNNNGTG 1 cut(s) 77
AspS9I GGNCC 1 cut(s) 128
AvaII GGWCC 1 cut(s) 128
BisI GCNGC 1 cut(s) 11
BlsI GCNGC 1 cut(s) 12
Bme18I GGWCC 1 cut(s) 128
BmgBI CACGTC 1 cut(s) 139
BmgT120I GGNCC 1 cut(s) 128
BseMII CTCAG 2 cut(s) 47, 101
BseYI CCCAGC 1 cut(s) 13
Bsp143I GATC 1 cut(s) 96
BspACI CCGC 1 cut(s) 11
BspCNI CTCAG 2 cut(s) 48, 102
BssMI GATC 1 cut(s) 96
BstDEI CTNAG 2 cut(s) 56, 110
BstKTI GATC 1 cut(s) 99
BstMBI GATC 1 cut(s) 96
BtgZI GCGATG 2 cut(s) 20, 38
BtrI CACGTC 1 cut(s) 139
Cfr13I GGNCC 1 cut(s) 128
CviAII CATG 1 cut(s) 19
CviJI RGCY 1 cut(s) 83
CviKI_1 RGCY 1 cut(s) 83
DdeI CTNAG 2 cut(s) 56, 110
DpnI GATC 1 cut(s) 98
DpnII GATC 1 cut(s) 96
Eco47I GGWCC 1 cut(s) 128
FaeI CATG 1 cut(s) 22
FaiI YATR 1 cut(s) 20
FatI CATG 1 cut(s) 18
Fnu4HI GCNGC 1 cut(s) 11
Fsp4HI GCNGC 1 cut(s) 11
GluI GCNGC 1 cut(s) 11
GsaI CCCAGC 1 cut(s) 17
Hin1II CATG 1 cut(s) 22
Hpy188I TCNGA 4 cut(s) 33, 57, 111, 143
Hpy99I CGWCG 1 cut(s) 143
HpyCH4IV ACGT 1 cut(s) 138
HpyF3I CTNAG 2 cut(s) 56, 110
HpySE526I ACGT 1 cut(s) 138
Hsp92II CATG 1 cut(s) 22
Kzo9I GATC 1 cut(s) 96
LpnPI CCDG 1 cut(s) 87
MaeII ACGT 1 cut(s) 138
MalI GATC 1 cut(s) 98
MboI GATC 1 cut(s) 96
MmeI TCCRAC 1 cut(s) 121
MslI CAYNNNNRTG 2 cut(s) 23, 77
MspA1I CMGCKG 1 cut(s) 13
NdeII GATC 1 cut(s) 96
NlaIII CATG 1 cut(s) 22
OliI CACNNNNGTG 1 cut(s) 77
PkrI GCNGC 1 cut(s) 12
PspFI CCCAGC 1 cut(s) 13
PspPI GGNCC 1 cut(s) 128
RseI CAYNNNNRTG 2 cut(s) 23, 77
SatI GCNGC 1 cut(s) 11
Sau3AI GATC 1 cut(s) 96
Sau96I GGNCC 1 cut(s) 128
SetI ASST 1 cut(s) 141
SgeI CNNG 5 cut(s) 26, 31, 87, 91, 114
SinI GGWCC 1 cut(s) 128
SmiMI CAYNNNNRTG 2 cut(s) 23, 77
SsiI CCGC 1 cut(s) 11
TaiI ACGT 1 cut(s) 141
TauI GCSGC 1 cut(s) 13
TspGWI ACGGA 1 cut(s) 132
VpaK11BI GGWCC 1 cut(s) 128
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.