Prupe.7G043000_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp07
Physical Location & Seq
Forward (+)
7935235 .. 7938849
3615 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.7G043000.1

Sequence Viewer

Length: 147 bp
ATGGCAATGCCATGGGCCATGACCTTTTGGATGGCAAAAATGGTGTGGTTGGCTGTGACCGGGTGGGTTTCGTCTTGCCTGACTGTTGCTGATGAGGTTGCTGGTTCCATCAGAACTGGAGATATTGGCGCTTTTCATGTTGGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

49

Amino Acids

5.19

Weight (kDa)

5.36

Isoelectric Point (pI)

41.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AoxI GGCC 1 cut(s) 15
AspLEI GCGC 1 cut(s) 131
AspS9I GGNCC 1 cut(s) 15
AsuC2I CCSGG 1 cut(s) 61
BccI CCATC 2 cut(s) 25, 116
BcnI CCSGG 1 cut(s) 61
BfoI RGCGCY 1 cut(s) 132
Bme1390I CCNGG 1 cut(s) 61
BmgT120I GGNCC 1 cut(s) 15
BmiI GGNNCC 1 cut(s) 106
BmrFI CCNGG 1 cut(s) 61
BpmI CTGGAG 1 cut(s) 138
BpuMI CCSGG 1 cut(s) 61
BsaJI CCNNGG 1 cut(s) 11
Bse1I ACTGG 1 cut(s) 121
Bse3DI GCAATG 1 cut(s) 12
BseDI CCNNGG 1 cut(s) 11
BseGI GGATG 1 cut(s) 36
BseMI GCAATG 1 cut(s) 12
BseNI ACTGG 1 cut(s) 121
BshFI GGCC 1 cut(s) 17
BsiSI CCGG 1 cut(s) 60
BsnI GGCC 1 cut(s) 17
Bsp19I CCATGG 1 cut(s) 11
BspANI GGCC 1 cut(s) 17
BspLI GGNNCC 1 cut(s) 106
BsrDI GCAATG 1 cut(s) 12
BsrI ACTGG 1 cut(s) 121
BssECI CCNNGG 1 cut(s) 11
BssT1I CCWWGG 1 cut(s) 11
Bst4CI ACNGT 1 cut(s) 85
BstDSI CCRYGG 1 cut(s) 11
BstF5I GGATG 1 cut(s) 36
BstH2I RGCGCY 1 cut(s) 132
BstHHI GCGC 1 cut(s) 131
BstSCI CCNGG 1 cut(s) 59
BsuRI GGCC 1 cut(s) 17
BtgI CCRYGG 1 cut(s) 11
BtsCI GGATG 1 cut(s) 36
CfoI GCGC 1 cut(s) 131
Cfr13I GGNCC 1 cut(s) 15
CviAII CATG 3 cut(s) 12, 19, 137
CviJI RGCY 3 cut(s) 17, 53, 144
CviKI_1 RGCY 3 cut(s) 17, 53, 144
Eco130I CCWWGG 1 cut(s) 11
EcoT14I CCWWGG 1 cut(s) 11
ErhI CCWWGG 1 cut(s) 11
FaeI CATG 3 cut(s) 15, 22, 140
FaiI YATR 3 cut(s) 13, 20, 138
FatI CATG 3 cut(s) 11, 18, 136
FokI GGATG 1 cut(s) 43
GlaI GCGC 1 cut(s) 130
GsuI CTGGAG 1 cut(s) 138
HaeII RGCGCY 1 cut(s) 132
HaeIII GGCC 1 cut(s) 17
HapII CCGG 1 cut(s) 60
HhaI GCGC 1 cut(s) 131
Hin1II CATG 3 cut(s) 15, 22, 140
Hin6I GCGC 1 cut(s) 129
HinP1I GCGC 1 cut(s) 129
HpaII CCGG 1 cut(s) 60
Hpy188I TCNGA 1 cut(s) 113
HpyCH4III ACNGT 1 cut(s) 85
Hsp92II CATG 3 cut(s) 15, 22, 140
HspAI GCGC 1 cut(s) 129
LpnPI CCDG 4 cut(s) 73, 87, 92, 102
MaeIII GTNAC 1 cut(s) 55
MnlI CCTC 1 cut(s) 88
MspI CCGG 1 cut(s) 60
MspR9I CCNGG 1 cut(s) 61
NciI CCSGG 1 cut(s) 61
NcoI CCATGG 1 cut(s) 11
NlaIII CATG 3 cut(s) 15, 22, 140
NlaIV GGNNCC 1 cut(s) 106
NmuCI GTSAC 1 cut(s) 55
PspN4I GGNNCC 1 cut(s) 106
PspPI GGNCC 1 cut(s) 15
Sau96I GGNCC 1 cut(s) 15
ScrFI CCNGG 1 cut(s) 61
SetI ASST 2 cut(s) 26, 99
SgeI CNNG 8 cut(s) 24, 31, 72, 73, 87, 91, 114, 129
StyD4I CCNGG 1 cut(s) 59
StyI CCWWGG 1 cut(s) 11
TaaI ACNGT 1 cut(s) 85
TseFI GTSAC 1 cut(s) 55
Tsp45I GTSAC 1 cut(s) 55
TspDTI ATGAA 1 cut(s) 125
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.