AT4G21192

Cytochrome c oxidase biogenesis protein Cmc1-like (InterPro IPR013892)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
4
OG0012248
Physical Location & Seq
Forward (+)
11294134 .. 11295543
1410 bp
Loading structure...
UTR
Exon/CDS
Intron
AT4G21192.1

Sequence Viewer

Length: 243 bp
ATGCATCCTCCACTTACACCACATAGACATCCAATGTGTCTGGAGATAATTGAGGAATTTCAAAAGTGTCATATAGACCATCCGATTGGGAAATTCTTTGGAGAATGTACAGAGCTGAAAGTAAAGCTTGATCGATGTTTCCGCCAAGAGAAAGCTGTGAAGCGGAAGGTAAATTTCGAACAAAGCAAGAAACTTCAAGAAAGACTGAAAGCTATAAGGAAAGAAGAAACCGCAGAGACTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Cmc1

Protein Analysis

80

Amino Acids

9.59

Weight (kDa)

9.0

Isoelectric Point (pI)

71.19

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Cmc1 PF08583 1 - 69 4.9e-18 Cytochrome c oxidase biogenesis protein Cmc1 like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 142, 163, 231
AcsI RAATTY 3 cut(s) 56, 92, 172
AfaI GTAC 1 cut(s) 109
AgsI TTSAA 2 cut(s) 62, 197
AluBI AGCT 4 cut(s) 115, 127, 155, 212
AluI AGCT 4 cut(s) 115, 127, 155, 212
Alw26I GTCTC 1 cut(s) 230
ApoI RAATTY 3 cut(s) 56, 92, 172
AsuII TTCGAA 1 cut(s) 177
BccI CCATC 1 cut(s) 87
BcoDI GTCTC 1 cut(s) 230
BmsI GCATC 1 cut(s) 13
BpmI CTGGAG 1 cut(s) 62
Bpu14I TTCGAA 1 cut(s) 177
Bsa29I ATCGAT 1 cut(s) 133
BseCI ATCGAT 1 cut(s) 133
BseGI GGATG 3 cut(s) 4, 28, 79
BshVI ATCGAT 1 cut(s) 133
BsmAI GTCTC 1 cut(s) 230
Bsp119I TTCGAA 1 cut(s) 177
Bsp1407I TGTACA 1 cut(s) 107
Bsp143I GATC 1 cut(s) 130
BspACI CCGC 3 cut(s) 142, 163, 231
BspDI ATCGAT 1 cut(s) 133
BspT104I TTCGAA 1 cut(s) 177
BsrGI TGTACA 1 cut(s) 107
BssMI GATC 1 cut(s) 130
BstAUI TGTACA 1 cut(s) 107
BstBI TTCGAA 1 cut(s) 177
BstF5I GGATG 3 cut(s) 4, 28, 79
BstKTI GATC 1 cut(s) 133
BstMAI GTCTC 1 cut(s) 230
BstMBI GATC 1 cut(s) 130
BstXI CCANNNNNNTGG 1 cut(s) 86
Bsu15I ATCGAT 1 cut(s) 133
BsuTUI ATCGAT 1 cut(s) 133
BtsCI GGATG 3 cut(s) 4, 28, 79
ClaI ATCGAT 1 cut(s) 133
Csp6I GTAC 1 cut(s) 108
CviJI RGCY 4 cut(s) 115, 127, 155, 212
CviKI_1 RGCY 4 cut(s) 115, 127, 155, 212
CviQI GTAC 1 cut(s) 108
DpnI GATC 1 cut(s) 132
DpnII GATC 1 cut(s) 130
EciI GGCGGA 1 cut(s) 131
EcoT22I ATGCAT 1 cut(s) 6
FaiI YATR 4 cut(s) 24, 72, 74, 215
FalI AAGNNNNNCTT 2 cut(s) 111, 143
FokI GGATG 2 cut(s) 15, 66
GsuI CTGGAG 1 cut(s) 62
HindIII AAGCTT 1 cut(s) 125
Hpy188I TCNGA 1 cut(s) 84
Hpy188III TCNNGA 2 cut(s) 41, 197
HpyAV CCTTC 1 cut(s) 160
HpyCH4V TGCA 1 cut(s) 4
Kzo9I GATC 1 cut(s) 130
LpnPI CCDG 1 cut(s) 26
LweI GCATC 1 cut(s) 13
MalI GATC 1 cut(s) 132
MboI GATC 1 cut(s) 130
MboII GAAGA 1 cut(s) 236
MluCI AATT 4 cut(s) 48, 56, 92, 172
MnlI CCTC 2 cut(s) 18, 46
Mph1103I ATGCAT 1 cut(s) 6
NdeII GATC 1 cut(s) 130
NsiI ATGCAT 1 cut(s) 6
NspV TTCGAA 1 cut(s) 177
RsaI GTAC 1 cut(s) 109
RsaNI GTAC 1 cut(s) 108
Sau3AI GATC 1 cut(s) 130
SetI ASST 5 cut(s) 117, 129, 157, 171, 214
SfaNI GCATC 1 cut(s) 13
SfuI TTCGAA 1 cut(s) 177
SgeI CNNG 5 cut(s) 53, 140, 158, 199, 209
Sse9I AATT 4 cut(s) 48, 56, 92, 172
SsiI CCGC 3 cut(s) 142, 163, 231
TaqI TCGA 2 cut(s) 133, 177
TasI AATT 4 cut(s) 48, 56, 92, 172
TatI WGTACW 1 cut(s) 107
XapI RAATTY 3 cut(s) 56, 92, 172
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.