AT5G12240

No description available

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
5
Physical Location & Seq
Reverse (-)
3958861 .. 3961020
2160 bp
Loading structure...
UTR
Exon/CDS
Intron
AT5G12240.2

Sequence Viewer

Length: 204 bp
ATGGACGACCAAGAGTTTCGTAGTCTCCTCGACCTCTTCCCAGTCGTACGTTCTCGTGACCACCGTGCTGAATTAGATTCTTCAAAGCAATCAACTTCACAGTCAGTTGTGGATCGAGAGGTAAGTGAATGGCACGATGCACCGACTGTTGCTGAGCCTAAAGACTTGCAATATCTGAAGACTGATCAAGGTTGGTGGGGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

67

Amino Acids

7.82

Weight (kDa)

4.61

Isoelectric Point (pI)

69.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0010096)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 120
AcuI CTGAAG 1 cut(s) 197
AfaI GTAC 1 cut(s) 48
AgsI TTSAA 1 cut(s) 84
Alw26I GTCTC 1 cut(s) 29
AlwI GGATC 1 cut(s) 120
BauI CACGAG 1 cut(s) 54
BbsI GAAGAC 1 cut(s) 185
BclI TGATCA 1 cut(s) 184
BcoDI GTCTC 1 cut(s) 29
BlpI GCTNAGC 1 cut(s) 153
BmrI ACTGGG 1 cut(s) 35
BmsI GCATC 1 cut(s) 127
BmuI ACTGGG 1 cut(s) 35
BpiI GAAGAC 1 cut(s) 185
Bpu1102I GCTNAGC 1 cut(s) 153
Bse1I ACTGG 1 cut(s) 41
BseMII CTCAG 1 cut(s) 144
BseNI ACTGG 1 cut(s) 41
BseRI GAGGAG 1 cut(s) 17
BsiWI CGTACG 1 cut(s) 46
BsmAI GTCTC 1 cut(s) 29
Bsp143I GATC 2 cut(s) 112, 184
Bsp1720I GCTNAGC 1 cut(s) 153
BspCNI CTCAG 1 cut(s) 145
BspPI GGATC 1 cut(s) 120
BsrI ACTGG 1 cut(s) 41
BssMI GATC 2 cut(s) 112, 184
BssSI CACGAG 1 cut(s) 54
Bst2BI CACGAG 1 cut(s) 54
Bst4CI ACNGT 3 cut(s) 65, 102, 148
Bst6I CTCTTC 1 cut(s) 41
BstDEI CTNAG 1 cut(s) 153
BstKTI GATC 2 cut(s) 115, 187
BstMAI GTCTC 1 cut(s) 29
BstMBI GATC 2 cut(s) 112, 184
BstV2I GAAGAC 1 cut(s) 185
Csp6I GTAC 1 cut(s) 47
CspCI CAANNNNNGTGG 1 cut(s) 176
CviJI RGCY 1 cut(s) 157
CviKI_1 RGCY 1 cut(s) 157
CviQI GTAC 1 cut(s) 47
DdeI CTNAG 1 cut(s) 153
DpnI GATC 2 cut(s) 114, 186
DpnII GATC 2 cut(s) 112, 184
Eam1104I CTCTTC 1 cut(s) 41
EarI CTCTTC 1 cut(s) 41
Eco57I CTGAAG 1 cut(s) 197
FbaI TGATCA 1 cut(s) 184
HinfI GANTC 1 cut(s) 77
Hpy188I TCNGA 1 cut(s) 177
Hpy188III TCNNGA 2 cut(s) 56, 116
HpyCH4III ACNGT 3 cut(s) 65, 102, 148
HpyCH4IV ACGT 1 cut(s) 49
HpyCH4V TGCA 2 cut(s) 140, 169
HpyF3I CTNAG 1 cut(s) 153
HpySE526I ACGT 1 cut(s) 49
Ksp22I TGATCA 1 cut(s) 184
Kzo9I GATC 2 cut(s) 112, 184
LpnPI CCDG 1 cut(s) 54
LweI GCATC 1 cut(s) 127
MaeII ACGT 1 cut(s) 49
MaeIII GTNAC 1 cut(s) 56
MalI GATC 2 cut(s) 114, 186
MboI GATC 2 cut(s) 112, 184
MboII GAAGA 3 cut(s) 28, 72, 190
MluCI AATT 1 cut(s) 71
MnlI CCTC 3 cut(s) 38, 44, 112
NdeII GATC 2 cut(s) 112, 184
NmuCI GTSAC 1 cut(s) 56
PcsI WCGNNNNNNNCGW 1 cut(s) 61
PfeI GAWTC 1 cut(s) 77
Pfl23II CGTACG 1 cut(s) 46
PspLI CGTACG 1 cut(s) 46
RsaI GTAC 1 cut(s) 48
RsaNI GTAC 1 cut(s) 47
Sau3AI GATC 2 cut(s) 112, 184
SetI ASST 4 cut(s) 36, 52, 123, 193
SfaNI GCATC 1 cut(s) 127
Sse9I AATT 1 cut(s) 71
TaaI ACNGT 3 cut(s) 65, 102, 148
TaiI ACGT 1 cut(s) 52
TaqI TCGA 2 cut(s) 30, 115
TasI AATT 1 cut(s) 71
TfiI GAWTC 1 cut(s) 77
TseFI GTSAC 1 cut(s) 56
Tsp45I GTSAC 1 cut(s) 56
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.