AT5G22210

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
5
OG0015331
Physical Location & Seq
Forward (+)
7358778 .. 7360051
1274 bp
Loading structure...
UTR
Exon/CDS
Intron
AT5G22210.1

Sequence Viewer

Length: 243 bp
ATGGGAAACAAAGCTACAACGGTGAAAGAAGAACGCGAAGAGATCCATTTGAAGATTGTACCTCCATTGGACAAAGTTTTTCTGCGTTGGCTCGCAAGAGATCTCCAGAGAGTTCATGGATTCAAACCGAAGAACAACACTCGTGCGATCACTCCTCCAGATAGCTACATCGAGTTTATGCGGTTAAATGGATCGCTTGATGTAGATTTAGATGACCCTGATCTTGCCCATTTGTTCAAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

80

Amino Acids

9.31

Weight (kDa)

6.83

Isoelectric Point (pI)

33.81

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
AtTam9 PF25111 1 - 80 5.7e-37 AtTam9 family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0015331)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G22210 AT5G22210
malus_domestica MD03G1152900.v1.1
prunus_persica Prupe.6G140000_v2.0.a1 Prupe.6G140000_v2.0.a1 Prupe.6G140000_v2.0.a1
rosa_chinensis RchiOBHm_Chr5g0047291
rosa_laevigata RLG00000034487
rosa_multiflora Rmu_sc0003441.1_g000095
rosa_roxburghii Rroxscaffold_1G00034070
rosa_rugosa Rorug05G0235500
rosa_samantha Rh5AG314500 Rh5BG323200 Rh5CG350400 Rh5DG334100
rosa_wichuraiana Rw5G029400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 36
AciI CCGC 1 cut(s) 181
AclWI GGATC 2 cut(s) 37, 199
AfaI GTAC 1 cut(s) 60
AgsI TTSAA 3 cut(s) 52, 124, 238
AluBI AGCT 2 cut(s) 14, 165
AluI AGCT 2 cut(s) 14, 165
AlwI GGATC 2 cut(s) 37, 199
AsuHPI GGTGA 1 cut(s) 34
BauI CACGAG 1 cut(s) 141
BglII AGATCT 1 cut(s) 100
BpmI CTGGAG 2 cut(s) 89, 141
BseRI GAGGAG 1 cut(s) 144
Bsh1236I CGCG 1 cut(s) 36
Bsp143I GATC 5 cut(s) 42, 100, 147, 191, 220
BspACI CCGC 1 cut(s) 181
BspFNI CGCG 1 cut(s) 36
BspPI GGATC 2 cut(s) 37, 199
BssMI GATC 5 cut(s) 42, 100, 147, 191, 220
BssSI CACGAG 1 cut(s) 141
Bst2BI CACGAG 1 cut(s) 141
Bst4CI ACNGT 1 cut(s) 22
Bst6I CTCTTC 1 cut(s) 33
BstC8I GCNNGC 1 cut(s) 93
BstFNI CGCG 1 cut(s) 36
BstKTI GATC 5 cut(s) 45, 103, 150, 194, 223
BstMBI GATC 5 cut(s) 42, 100, 147, 191, 220
BstUI CGCG 1 cut(s) 36
BstX2I RGATCY 2 cut(s) 42, 100
BstYI RGATCY 2 cut(s) 42, 100
Cac8I GCNNGC 1 cut(s) 93
Csp6I GTAC 1 cut(s) 59
CviAII CATG 1 cut(s) 116
CviJI RGCY 3 cut(s) 14, 91, 165
CviKI_1 RGCY 3 cut(s) 14, 91, 165
CviQI GTAC 1 cut(s) 59
DpnI GATC 5 cut(s) 44, 102, 149, 193, 222
DpnII GATC 5 cut(s) 42, 100, 147, 191, 220
Eam1104I CTCTTC 1 cut(s) 33
EarI CTCTTC 1 cut(s) 33
FaeI CATG 1 cut(s) 119
FaiI YATR 2 cut(s) 117, 179
FatI CATG 1 cut(s) 115
GsuI CTGGAG 2 cut(s) 89, 141
Hin1II CATG 1 cut(s) 119
HinfI GANTC 1 cut(s) 120
HphI GGTGA 1 cut(s) 34
Hpy188III TCNNGA 2 cut(s) 106, 158
HpyCH4III ACNGT 1 cut(s) 22
Hsp92II CATG 1 cut(s) 119
Kzo9I GATC 5 cut(s) 42, 100, 147, 191, 220
LpnPI CCDG 3 cut(s) 119, 171, 231
MalI GATC 5 cut(s) 44, 102, 149, 193, 222
MboI GATC 5 cut(s) 42, 100, 147, 191, 220
MboII GAAGA 4 cut(s) 41, 50, 64, 142
MflI RGATCY 2 cut(s) 42, 100
MnlI CCTC 2 cut(s) 72, 165
MseI TTAA 1 cut(s) 185
MvnI CGCG 1 cut(s) 36
NdeII GATC 5 cut(s) 42, 100, 147, 191, 220
NlaIII CATG 1 cut(s) 119
PfeI GAWTC 1 cut(s) 120
PsuI RGATCY 2 cut(s) 42, 100
RsaI GTAC 1 cut(s) 60
RsaNI GTAC 1 cut(s) 59
SaqAI TTAA 1 cut(s) 185
Sau3AI GATC 5 cut(s) 42, 100, 147, 191, 220
SetI ASST 3 cut(s) 16, 64, 167
SsiI CCGC 1 cut(s) 181
TaaI ACNGT 1 cut(s) 22
TaqI TCGA 1 cut(s) 171
TfiI GAWTC 1 cut(s) 120
Tru1I TTAA 1 cut(s) 185
Tru9I TTAA 1 cut(s) 185
TspDTI ATGAA 1 cut(s) 104
XcmI CCANNNNNNNNNTGG 1 cut(s) 113
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.