Rmu_sc0003441.1_g000095

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003441.1
Physical Location & Seq
Forward (+)
389129 .. 389362
234 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003441.1_g000095.1.cds

Sequence Viewer

Length: 234 bp
atgggaaacaagcctgcaaaacaagaaagggaagaaatcttcttgaaagttgttcctccactggatcgtgcatatgttaggtggcttgctcaagatcttgagaggattcacggcttcacaccagcaaaccctcgtgcagtgaagcccccagatcattatattgagtacatgcgcttgaatgggtggttagatgtagacttgagtgatcctgatctagcctatttattcaagtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

77

Amino Acids

9.07

Weight (kDa)

6.06

Isoelectric Point (pI)

53.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015331)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 195
AclWI GGATC 2 cut(s) 72, 200
AfaI GTAC 1 cut(s) 167
AgsI TTSAA 3 cut(s) 46, 178, 229
AlwI GGATC 2 cut(s) 72, 200
AspLEI GCGC 1 cut(s) 174
BauI CACGAG 1 cut(s) 132
BceAI ACGGC 1 cut(s) 127
BfaI CTAG 1 cut(s) 215
BglII AGATCT 1 cut(s) 94
BpuEI CTTGAG 3 cut(s) 75, 119, 220
BsaBI GATNNNNATC 1 cut(s) 210
Bse1I ACTGG 1 cut(s) 66
Bse8I GATNNNNATC 1 cut(s) 210
BseJI GATNNNNATC 1 cut(s) 210
BseNI ACTGG 1 cut(s) 66
BsgI GTGCAG 1 cut(s) 156
Bsp143I GATC 5 cut(s) 64, 94, 151, 205, 211
BspPI GGATC 2 cut(s) 72, 200
BsrI ACTGG 1 cut(s) 66
BssMI GATC 5 cut(s) 64, 94, 151, 205, 211
BssSI CACGAG 1 cut(s) 132
Bst2BI CACGAG 1 cut(s) 132
BstC8I GCNNGC 2 cut(s) 15, 87
BstHHI GCGC 1 cut(s) 174
BstKTI GATC 5 cut(s) 67, 97, 154, 208, 214
BstMBI GATC 5 cut(s) 64, 94, 151, 205, 211
BstNSI RCATGY 1 cut(s) 172
BstX2I RGATCY 1 cut(s) 94
BstYI RGATCY 1 cut(s) 94
BtsI GCAGTG 1 cut(s) 144
BtsIMutI CAGTG 2 cut(s) 59, 144
Cac8I GCNNGC 2 cut(s) 15, 87
CfoI GCGC 1 cut(s) 174
Csp6I GTAC 1 cut(s) 166
CviAII CATG 1 cut(s) 169
CviJI RGCY 5 cut(s) 13, 85, 114, 145, 218
CviKI_1 RGCY 5 cut(s) 13, 85, 114, 145, 218
CviQI GTAC 1 cut(s) 166
DpnI GATC 5 cut(s) 66, 96, 153, 207, 213
DpnII GATC 5 cut(s) 64, 94, 151, 205, 211
FaeI CATG 1 cut(s) 172
FaiI YATR 4 cut(s) 73, 75, 159, 170
FatI CATG 1 cut(s) 168
FauNDI CATATG 1 cut(s) 73
FblI GTMKAC 1 cut(s) 195
FspBI CTAG 1 cut(s) 215
GlaI GCGC 1 cut(s) 173
HhaI GCGC 1 cut(s) 174
Hin1II CATG 1 cut(s) 172
Hin6I GCGC 1 cut(s) 172
HinP1I GCGC 1 cut(s) 172
HinfI GANTC 1 cut(s) 106
Hpy166II GTNNAC 1 cut(s) 196
Hpy188III TCNNGA 4 cut(s) 43, 92, 98, 209
Hpy8I GTNNAC 1 cut(s) 196
HpyCH4V TGCA 3 cut(s) 17, 71, 137
Hsp92II CATG 1 cut(s) 172
HspAI GCGC 1 cut(s) 172
Kzo9I GATC 5 cut(s) 64, 94, 151, 205, 211
LpnPI CCDG 5 cut(s) 27, 47, 135, 162, 222
MaeI CTAG 1 cut(s) 215
MalI GATC 5 cut(s) 66, 96, 153, 207, 213
MboI GATC 5 cut(s) 64, 94, 151, 205, 211
MboII GAAGA 2 cut(s) 31, 44
MflI RGATCY 1 cut(s) 94
MnlI CCTC 3 cut(s) 66, 96, 141
NdeI CATATG 1 cut(s) 73
NdeII GATC 5 cut(s) 64, 94, 151, 205, 211
NlaIII CATG 1 cut(s) 172
NspI RCATGY 1 cut(s) 172
PfeI GAWTC 1 cut(s) 106
PsuI RGATCY 1 cut(s) 94
RsaI GTAC 1 cut(s) 167
RsaNI GTAC 1 cut(s) 166
Sau3AI GATC 5 cut(s) 64, 94, 151, 205, 211
SetI ASST 1 cut(s) 83
SmlI CTYRAG 3 cut(s) 90, 98, 199
SmoI CTYRAG 3 cut(s) 90, 98, 199
SspMI CTAG 1 cut(s) 215
TatI WGTACW 1 cut(s) 165
TfiI GAWTC 1 cut(s) 106
TscAI CASTG 2 cut(s) 66, 144
TspRI CASTG 2 cut(s) 66, 144
XceI RCATGY 1 cut(s) 172
XmiI GTMKAC 1 cut(s) 195
XspI CTAG 1 cut(s) 215
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.