AT5G52545

RNA-binding protein 18 isoform X1

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
5
Physical Location & Seq
Reverse (-)
21323781 .. 21325604
1824 bp
Loading structure...
UTR
Exon/CDS
Intron
AT5G52545.2

Sequence Viewer

Length: 240 bp
ATGCATGGGAGATTAGCTTGTGGTAGGCCTTTAGTGGTGCGTCTAGCTAGTGAGAAGCATCTAGAAGATTCCTCTCATGATCACTCCAAAAGATCATTACCAGAAGGAAACAGAACCAGATTTGTAAACGGGAGCAGCTCAGGACAAATGAGCCGAGACGAAAAAGTAACTGCCATTAAGAACAAACTCAAAGCTTTGGAAGAAGATGAGAAACGTGATCCCAAGAAACAGAAAATTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

79

Amino Acids

8.95

Weight (kDa)

9.84

Isoelectric Point (pI)

68.02

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RRM_1 PF00076 15 - 87 3.4e-12 RNA recognition motif
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0011461)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 212
AcsI RAATTY 1 cut(s) 234
AluBI AGCT 4 cut(s) 17, 47, 138, 194
AluI AGCT 4 cut(s) 17, 47, 138, 194
Alw26I GTCTC 1 cut(s) 150
AlwI GGATC 1 cut(s) 212
AoxI GGCC 1 cut(s) 26
ApeKI GCWGC 1 cut(s) 135
ApoI RAATTY 1 cut(s) 234
BbvI GCAGC 1 cut(s) 147
BclI TGATCA 1 cut(s) 79
BcoDI GTCTC 1 cut(s) 150
BfaI CTAG 3 cut(s) 44, 48, 62
BisI GCNGC 1 cut(s) 136
BlsI GCNGC 1 cut(s) 137
BmsI GCATC 1 cut(s) 67
Bpu10I CCTNAGC 1 cut(s) 139
BseMII CTCAG 1 cut(s) 153
BseXI GCAGC 1 cut(s) 147
BshFI GGCC 1 cut(s) 28
BsmAI GTCTC 1 cut(s) 150
BsmBI CGTCTC 1 cut(s) 150
BsnI GGCC 1 cut(s) 28
Bsp143I GATC 3 cut(s) 79, 92, 217
BspANI GGCC 1 cut(s) 28
BspCNI CTCAG 1 cut(s) 152
BspHI TCATGA 1 cut(s) 76
BspPI GGATC 1 cut(s) 212
BssMI GATC 3 cut(s) 79, 92, 217
BstDEI CTNAG 1 cut(s) 139
BstKTI GATC 3 cut(s) 82, 95, 220
BstMAI GTCTC 1 cut(s) 150
BstMBI GATC 3 cut(s) 79, 92, 217
BstV1I GCAGC 1 cut(s) 147
BsuRI GGCC 1 cut(s) 28
CciI TCATGA 1 cut(s) 76
CseI GACGC 1 cut(s) 29
CviAII CATG 2 cut(s) 5, 77
CviJI RGCY 6 cut(s) 17, 28, 47, 138, 153, 194
CviKI_1 RGCY 6 cut(s) 17, 28, 47, 138, 153, 194
DdeI CTNAG 1 cut(s) 139
DpnI GATC 3 cut(s) 81, 94, 219
DpnII GATC 3 cut(s) 79, 92, 217
Eco147I AGGCCT 1 cut(s) 28
EcoT22I ATGCAT 1 cut(s) 6
Esp3I CGTCTC 1 cut(s) 150
FaeI CATG 2 cut(s) 8, 80
FaiI YATR 2 cut(s) 6, 78
FatI CATG 2 cut(s) 4, 76
FbaI TGATCA 1 cut(s) 79
Fnu4HI GCNGC 1 cut(s) 136
Fsp4HI GCNGC 1 cut(s) 136
FspBI CTAG 3 cut(s) 44, 48, 62
GluI GCNGC 1 cut(s) 136
HaeIII GGCC 1 cut(s) 28
HgaI GACGC 1 cut(s) 29
Hin1II CATG 2 cut(s) 8, 80
HindIII AAGCTT 1 cut(s) 192
HinfI GANTC 1 cut(s) 68
Hpy166II GTNNAC 1 cut(s) 127
Hpy188III TCNNGA 3 cut(s) 62, 77, 141
Hpy8I GTNNAC 1 cut(s) 127
HpyAV CCTTC 1 cut(s) 98
HpyCH4IV ACGT 1 cut(s) 214
HpyCH4V TGCA 1 cut(s) 4
HpyF3I CTNAG 1 cut(s) 139
HpySE526I ACGT 1 cut(s) 214
Hsp92II CATG 2 cut(s) 8, 80
Ksp22I TGATCA 1 cut(s) 79
Kzo9I GATC 3 cut(s) 79, 92, 217
LmnI GCTCC 1 cut(s) 132
LpnPI CCDG 3 cut(s) 114, 126, 130
Lsp1109I GCAGC 1 cut(s) 147
LweI GCATC 1 cut(s) 67
MaeI CTAG 3 cut(s) 44, 48, 62
MaeII ACGT 1 cut(s) 214
MaeIII GTNAC 1 cut(s) 166
MalI GATC 3 cut(s) 81, 94, 219
MboI GATC 3 cut(s) 79, 92, 217
MboII GAAGA 3 cut(s) 77, 212, 215
MluCI AATT 1 cut(s) 234
MnlI CCTC 1 cut(s) 82
Mph1103I ATGCAT 1 cut(s) 6
MseI TTAA 2 cut(s) 177, 238
NdeII GATC 3 cut(s) 79, 92, 217
NlaIII CATG 2 cut(s) 8, 80
NmeAIII GCCGAG 1 cut(s) 179
NsiI ATGCAT 1 cut(s) 6
PagI TCATGA 1 cut(s) 76
PceI AGGCCT 1 cut(s) 28
PfeI GAWTC 1 cut(s) 68
PkrI GCNGC 1 cut(s) 137
SaqAI TTAA 2 cut(s) 177, 238
SatI GCNGC 1 cut(s) 136
Sau3AI GATC 3 cut(s) 79, 92, 217
SetI ASST 5 cut(s) 19, 49, 140, 196, 217
SfaNI GCATC 1 cut(s) 67
Sse9I AATT 1 cut(s) 234
SseBI AGGCCT 1 cut(s) 28
SspMI CTAG 3 cut(s) 44, 48, 62
StuI AGGCCT 1 cut(s) 28
TaiI ACGT 1 cut(s) 217
TasI AATT 1 cut(s) 234
TfiI GAWTC 1 cut(s) 68
Tru1I TTAA 2 cut(s) 177, 238
Tru9I TTAA 2 cut(s) 177, 238
TseI GCWGC 1 cut(s) 135
XapI RAATTY 1 cut(s) 234
XbaI TCTAGA 1 cut(s) 61
XspI CTAG 3 cut(s) 44, 48, 62
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.