AT5G53560

Belongs to the cytochrome b5 family

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
5
Physical Location & Seq
Forward (+)
21759329 .. 21760578
1250 bp
Loading structure...
UTR
Exon/CDS
Intron
AT5G53560.1

Sequence Viewer

Length: 405 bp
ATGTCTTCAGATCGGAAGGTTCTAAGTTTTGAAGAAGTTTCAAAGCACAACAAAACTAAGGATTGTTGGCTTATTATTTCCGGCAAGGTGTATGATGTGACTCCATTCATGGATGATCATCCTGGAGGCGATGAAGTCTTGTTGTCCTCAACAGGGAAAGATGCTACAAATGATTTTGAAGACGTTGGTCACAGCGACACTGCAAGGGACATGATGGACAAATATTTCATTGGTGAGATTGATTCGTCTAGTGTTCCAGCAACTAGGACATACGTTGCACCACAGCAACCAGCCTACAACCAAGACAAGACACCAGAATTCATTATCAAGATTCTTCAGTTCCTTGTTCCGATCTTGATCTTGGGATTGGCTCTTGTCGTCCGTCACTATACCAAGAAAGACTAG

Protein Analysis

134

Amino Acids

15.08

Weight (kDa)

5.11

Isoelectric Point (pI)

48.09

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Cyt-b5 PF00173 10 - 80 5.3e-31 Cytochrome b5-like Heme/Steroid binding domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016511)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G53560
fragaria_vesca FvH4_7g32530
malus_domestica MD01G1226000.v1.1 MD07G1296500.v1.1
prunus_persica Prupe.2G316100_v2.0.a1 Prupe.2G316100_v2.0.a1
pyrus_communis pycom01g23460
rosa_chinensis RchiOBHm_Chr1g0382371
rosa_roxburghii Rroxscaffold_7G00167650
rosa_samantha Rh1AG458500 Rh1BG414800 Rh1CG428900 Rh1DG446900
rosa_wichuraiana Rw1G041250

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 317
AcuI CTGAAG 1 cut(s) 320
AfiI CCNNNNNNNGG 1 cut(s) 153
AgsI TTSAA 3 cut(s) 32, 42, 179
AjnI CCWGG 1 cut(s) 121
ApoI RAATTY 1 cut(s) 317
AsuHPI GGTGA 1 cut(s) 245
BbsI GAAGAC 1 cut(s) 186
BccI CCATC 1 cut(s) 208
BciT130I CCWGG 1 cut(s) 123
BclI TGATCA 1 cut(s) 115
BfaI CTAG 3 cut(s) 249, 264, 403
Bme1390I CCNGG 1 cut(s) 123
BmrFI CCNGG 1 cut(s) 123
BmsI GCATC 1 cut(s) 151
BoxI GACNNNNGTC 1 cut(s) 186
BpiI GAAGAC 1 cut(s) 186
BpmI CTGGAG 1 cut(s) 144
BsaBI GATNNNNATC 2 cut(s) 117, 356
Bsc4I CCNNNNNNNGG 1 cut(s) 153
Bse8I GATNNNNATC 2 cut(s) 117, 356
BseBI CCWGG 1 cut(s) 123
BseGI GGATG 2 cut(s) 118, 118
BseJI GATNNNNATC 2 cut(s) 117, 356
BseLI CCNNNNNNNGG 1 cut(s) 153
BsiSI CCGG 1 cut(s) 81
BslFI GGGAC 1 cut(s) 221
BslI CCNNNNNNNGG 1 cut(s) 153
BsmFI GGGAC 1 cut(s) 221
Bsp143I GATC 4 cut(s) 10, 115, 351, 357
BssMI GATC 4 cut(s) 10, 115, 351, 357
Bst2UI CCWGG 1 cut(s) 123
BstDEI CTNAG 2 cut(s) 23, 57
BstF5I GGATG 2 cut(s) 118, 118
BstKTI GATC 4 cut(s) 13, 118, 354, 360
BstMBI GATC 4 cut(s) 10, 115, 351, 357
BstNI CCWGG 1 cut(s) 123
BstPAI GACNNNNGTC 1 cut(s) 186
BstSCI CCNGG 1 cut(s) 121
BstV2I GAAGAC 1 cut(s) 186
BtgZI GCGATG 1 cut(s) 144
BtsCI GGATG 2 cut(s) 118, 118
BtsI GCAGTG 1 cut(s) 198
BtsIMutI CAGTG 1 cut(s) 198
CviAII CATG 2 cut(s) 109, 211
CviJI RGCY 3 cut(s) 70, 293, 371
CviKI_1 RGCY 3 cut(s) 70, 293, 371
DdeI CTNAG 2 cut(s) 23, 57
DpnI GATC 4 cut(s) 12, 117, 353, 359
DpnII GATC 4 cut(s) 10, 115, 351, 357
Eco57I CTGAAG 1 cut(s) 320
EcoRI GAATTC 1 cut(s) 317
EcoRII CCWGG 1 cut(s) 121
FaeI CATG 2 cut(s) 112, 214
FaiI YATR 5 cut(s) 93, 110, 212, 271, 390
FaqI GGGAC 1 cut(s) 221
FatI CATG 2 cut(s) 108, 210
FbaI TGATCA 1 cut(s) 115
FokI GGATG 2 cut(s) 105, 125
FspBI CTAG 3 cut(s) 249, 264, 403
GsuI CTGGAG 1 cut(s) 144
HapII CCGG 1 cut(s) 81
Hin1II CATG 2 cut(s) 112, 214
HinfI GANTC 3 cut(s) 100, 242, 331
HpaII CCGG 1 cut(s) 81
HphI GGTGA 1 cut(s) 245
Hpy188I TCNGA 3 cut(s) 10, 15, 351
Hpy188III TCNNGA 2 cut(s) 328, 355
HpyAV CCTTC 1 cut(s) 10
HpyCH4IV ACGT 2 cut(s) 183, 273
HpyCH4V TGCA 2 cut(s) 203, 278
HpyF3I CTNAG 2 cut(s) 23, 57
HpySE526I ACGT 2 cut(s) 183, 273
Hsp92II CATG 2 cut(s) 112, 214
Ksp22I TGATCA 1 cut(s) 115
Kzo9I GATC 4 cut(s) 10, 115, 351, 357
LpnPI CCDG 7 cut(s) 94, 108, 135, 138, 270, 303, 327
LweI GCATC 1 cut(s) 151
MaeI CTAG 3 cut(s) 249, 264, 403
MaeII ACGT 2 cut(s) 183, 273
MaeIII GTNAC 3 cut(s) 97, 188, 383
MalI GATC 4 cut(s) 12, 117, 353, 359
MboI GATC 4 cut(s) 10, 115, 351, 357
MboII GAAGA 3 cut(s) 44, 191, 326
MluCI AATT 1 cut(s) 317
MlyI GAGTC 1 cut(s) 94
MnlI CCTC 2 cut(s) 119, 157
MspI CCGG 1 cut(s) 81
MspR9I CCNGG 1 cut(s) 123
MvaI CCWGG 1 cut(s) 123
NdeII GATC 4 cut(s) 10, 115, 351, 357
NlaIII CATG 2 cut(s) 112, 214
NmuCI GTSAC 3 cut(s) 97, 188, 383
PfeI GAWTC 2 cut(s) 242, 331
PfoI TCCNGGA 1 cut(s) 121
PleI GAGTC 1 cut(s) 94
PpsI GAGTC 1 cut(s) 94
PshAI GACNNNNGTC 1 cut(s) 186
Psp6I CCWGG 1 cut(s) 121
PspGI CCWGG 1 cut(s) 121
Sau3AI GATC 4 cut(s) 10, 115, 351, 357
SchI GAGTC 1 cut(s) 94
ScrFI CCNGG 1 cut(s) 123
SetI ASST 4 cut(s) 21, 90, 186, 276
SfaNI GCATC 1 cut(s) 151
Sse9I AATT 1 cut(s) 317
SspI AATATT 1 cut(s) 224
SspMI CTAG 3 cut(s) 249, 264, 403
StyD4I CCNGG 1 cut(s) 121
TaiI ACGT 2 cut(s) 186, 276
TasI AATT 1 cut(s) 317
TfiI GAWTC 2 cut(s) 242, 331
TscAI CASTG 1 cut(s) 205
TseFI GTSAC 3 cut(s) 97, 188, 383
Tsp45I GTSAC 3 cut(s) 97, 188, 383
TspDTI ATGAA 4 cut(s) 97, 147, 217, 310
TspGWI ACGGA 1 cut(s) 371
TspRI CASTG 1 cut(s) 205
XapI RAATTY 1 cut(s) 317
XspI CTAG 3 cut(s) 249, 264, 403
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.