FvH4_1g21780

No description available

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb1
Physical Location & Seq
Reverse (-)
13721390 .. 13721617
228 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_1g21780.t1

Sequence Viewer

Length: 228 bp
ATGTCTTCCCTTGGTGCGAGCTATGCTGGTGTTTATGTCATGCAGAAGAGGCAGAAGGAGAAACTGGAGAGGAAGAAGCAAGAGGAGAGAGCCAGGAGAGGAGATGGCAACCGTGCTTTAGATGATCAAGATACAAGGGCTACACAATATGGCCGGAGTAAGAAGGTCCATCCGGGAAATTCTCCGGCTTCGGACAGCACCGGTCCGGCAAATGCTAACCAGAAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

76

Amino Acids

8.31

Weight (kDa)

10.06

Isoelectric Point (pI)

51.59

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 151
AcsI RAATTY 1 cut(s) 178
AgeI ACCGGT 1 cut(s) 200
AjnI CCWGG 1 cut(s) 92
AluBI AGCT 1 cut(s) 21
AluI AGCT 1 cut(s) 21
AoxI GGCC 1 cut(s) 151
ApoI RAATTY 1 cut(s) 178
AsiGI ACCGGT 1 cut(s) 200
AspS9I GGNCC 2 cut(s) 166, 203
AsuC2I CCSGG 1 cut(s) 174
AvaII GGWCC 2 cut(s) 166, 203
BccI CCATC 2 cut(s) 98, 177
BciT130I CCWGG 1 cut(s) 94
BclI TGATCA 1 cut(s) 124
BcnI CCSGG 1 cut(s) 174
Bme1390I CCNGG 2 cut(s) 94, 174
Bme18I GGWCC 2 cut(s) 166, 203
BmgT120I GGNCC 2 cut(s) 166, 203
BmrFI CCNGG 2 cut(s) 94, 174
BpmI CTGGAG 1 cut(s) 86
BpuMI CCSGG 1 cut(s) 174
BsaJI CCNNGG 1 cut(s) 10
BsaWI WCCGGW 1 cut(s) 200
Bse118I RCCGGY 1 cut(s) 200
Bse1I ACTGG 1 cut(s) 69
BseBI CCWGG 1 cut(s) 94
BseDI CCNNGG 1 cut(s) 10
BseGI GGATG 1 cut(s) 169
BseNI ACTGG 1 cut(s) 69
BseRI GAGGAG 2 cut(s) 98, 114
BshFI GGCC 1 cut(s) 153
BshTI ACCGGT 1 cut(s) 200
BsiSI CCGG 5 cut(s) 154, 173, 185, 201, 206
BsnI GGCC 1 cut(s) 153
Bsp143I GATC 1 cut(s) 124
BspANI GGCC 1 cut(s) 153
BsrFI RCCGGY 1 cut(s) 200
BsrI ACTGG 1 cut(s) 69
BssAI RCCGGY 1 cut(s) 200
BssECI CCNNGG 1 cut(s) 10
BssMI GATC 1 cut(s) 124
BssT1I CCWWGG 1 cut(s) 10
Bst2UI CCWGG 1 cut(s) 94
Bst4CI ACNGT 1 cut(s) 113
Bst6I CTCTTC 1 cut(s) 41
BstC8I GCNNGC 1 cut(s) 19
BstF5I GGATG 1 cut(s) 169
BstKTI GATC 1 cut(s) 127
BstMBI GATC 1 cut(s) 124
BstMWI GCNNNNNNNGC 2 cut(s) 23, 49
BstNI CCWGG 1 cut(s) 94
BstSCI CCNGG 2 cut(s) 92, 172
BsuRI GGCC 1 cut(s) 153
BtsCI GGATG 1 cut(s) 169
Cac8I GCNNGC 1 cut(s) 19
Cfr10I RCCGGY 1 cut(s) 200
Cfr13I GGNCC 2 cut(s) 166, 203
CpoI CGGWCCG 1 cut(s) 203
CspAI ACCGGT 1 cut(s) 200
CspI CGGWCCG 1 cut(s) 203
CviAII CATG 1 cut(s) 40
CviJI RGCY 5 cut(s) 21, 92, 140, 153, 188
CviKI_1 RGCY 5 cut(s) 21, 92, 140, 153, 188
DpnI GATC 1 cut(s) 126
DpnII GATC 1 cut(s) 124
EaeI YGGCCR 1 cut(s) 151
Eam1104I CTCTTC 1 cut(s) 41
EarI CTCTTC 1 cut(s) 41
Eco130I CCWWGG 1 cut(s) 10
Eco47I GGWCC 2 cut(s) 166, 203
EcoRII CCWGG 1 cut(s) 92
EcoT14I CCWWGG 1 cut(s) 10
ErhI CCWWGG 1 cut(s) 10
FaeI CATG 1 cut(s) 43
FaiI YATR 4 cut(s) 24, 36, 41, 150
FatI CATG 1 cut(s) 39
FbaI TGATCA 1 cut(s) 124
FokI GGATG 1 cut(s) 156
GsuI CTGGAG 1 cut(s) 86
HaeIII GGCC 1 cut(s) 153
HapII CCGG 5 cut(s) 154, 173, 185, 201, 206
Hin1II CATG 1 cut(s) 43
HpaII CCGG 5 cut(s) 154, 173, 185, 201, 206
Hpy188I TCNGA 1 cut(s) 193
Hpy188III TCNNGA 1 cut(s) 128
HpyAV CCTTC 2 cut(s) 49, 157
HpyCH4III ACNGT 1 cut(s) 113
HpyCH4V TGCA 1 cut(s) 43
HpyF10VI GCNNNNNNNGC 2 cut(s) 23, 49
Hsp92II CATG 1 cut(s) 43
Ksp22I TGATCA 1 cut(s) 124
Kzo9I GATC 1 cut(s) 124
LpnPI CCDG 9 cut(s) 12, 50, 79, 106, 167, 186, 198, 214, 219
MalI GATC 1 cut(s) 126
MboI GATC 1 cut(s) 124
MboII GAAGA 2 cut(s) 58, 85
MluCI AATT 1 cut(s) 178
MnlI CCTC 4 cut(s) 42, 63, 76, 92
MspI CCGG 5 cut(s) 154, 173, 185, 201, 206
MspR9I CCNGG 2 cut(s) 94, 174
MvaI CCWGG 1 cut(s) 94
MwoI GCNNNNNNNGC 2 cut(s) 23, 49
NciI CCSGG 1 cut(s) 174
NdeII GATC 1 cut(s) 124
NlaIII CATG 1 cut(s) 43
PfoI TCCNGGA 1 cut(s) 172
PinAI ACCGGT 1 cut(s) 200
Psp6I CCWGG 1 cut(s) 92
PspGI CCWGG 1 cut(s) 92
PspPI GGNCC 2 cut(s) 166, 203
Rsr2I CGGWCCG 1 cut(s) 203
RsrII CGGWCCG 1 cut(s) 203
Sau3AI GATC 1 cut(s) 124
Sau96I GGNCC 2 cut(s) 166, 203
ScrFI CCNGG 2 cut(s) 94, 174
SetI ASST 2 cut(s) 23, 168
SinI GGWCC 2 cut(s) 166, 203
Sse9I AATT 1 cut(s) 178
StyD4I CCNGG 2 cut(s) 92, 172
StyI CCWWGG 1 cut(s) 10
TaaI ACNGT 1 cut(s) 113
TasI AATT 1 cut(s) 178
VpaK11BI GGWCC 2 cut(s) 166, 203
XapI RAATTY 1 cut(s) 178
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.