Prupe.6G178000_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp06
Physical Location & Seq
Forward (+)
18309597 .. 18309956
360 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.6G178000.1

Sequence Viewer

Length: 306 bp
ATGTCTTCCATTGGGGCTAGCTATGCTGGGGTTTATGTGATGCAGAAGCGACAGAAGGAGAAAATGGAGAAGAAGGAAGACGAAACTAGAGGGAAAGGAGAGAGCAGTATAGCAAAGGAGAGCAAAGTCTCTGCACCTGGGAGGACCAAAAAGGTCCATGCAGAGAATTTTCAGGCCTCGGACACTACCCTTTCTAAAGTTTTTACAAATGCTTATGCTTGGTTGATTTTTCAAGTGATTTATTCTTGTTTAACTTGTGTTTTGTATAAGTTTCCAAGTTTTAGGTTGTGCTTCCATTTTCACCTT
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

102

Amino Acids

11.64

Weight (kDa)

9.46

Isoelectric Point (pI)

33.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 166
AgsI TTSAA 1 cut(s) 233
AjnI CCWGG 1 cut(s) 136
AluBI AGCT 1 cut(s) 21
AluI AGCT 1 cut(s) 21
Alw26I GTCTC 1 cut(s) 133
AoxI GGCC 1 cut(s) 174
ApoI RAATTY 1 cut(s) 166
AspS9I GGNCC 2 cut(s) 144, 154
AsuHPI GGTGA 1 cut(s) 293
AsuNHI GCTAGC 1 cut(s) 17
AvaII GGWCC 2 cut(s) 144, 154
BbsI GAAGAC 1 cut(s) 84
BciT130I CCWGG 1 cut(s) 138
BcoDI GTCTC 1 cut(s) 133
BfaI CTAG 2 cut(s) 18, 87
Bme1390I CCNGG 1 cut(s) 138
Bme18I GGWCC 2 cut(s) 144, 154
BmgT120I GGNCC 2 cut(s) 144, 154
BmrFI CCNGG 1 cut(s) 138
BmsI GCATC 1 cut(s) 30
BmtI GCTAGC 1 cut(s) 21
BpiI GAAGAC 1 cut(s) 84
BsaJI CCNNGG 2 cut(s) 137, 177
BseBI CCWGG 1 cut(s) 138
BseDI CCNNGG 2 cut(s) 137, 177
BseYI CCCAGC 1 cut(s) 26
BsgI GTGCAG 1 cut(s) 117
BshFI GGCC 1 cut(s) 176
BsmAI GTCTC 1 cut(s) 133
BsnI GGCC 1 cut(s) 176
BspANI GGCC 1 cut(s) 176
BspOI GCTAGC 1 cut(s) 21
BssECI CCNNGG 2 cut(s) 137, 177
Bst2UI CCWGG 1 cut(s) 138
BstC8I GCNNGC 1 cut(s) 19
BstMAI GTCTC 1 cut(s) 133
BstMWI GCNNNNNNNGC 1 cut(s) 23
BstNI CCWGG 1 cut(s) 138
BstSCI CCNGG 1 cut(s) 136
BstV2I GAAGAC 1 cut(s) 84
BsuRI GGCC 1 cut(s) 176
Cac8I GCNNGC 1 cut(s) 19
Cfr13I GGNCC 2 cut(s) 144, 154
CviAII CATG 1 cut(s) 158
CviJI RGCY 3 cut(s) 17, 21, 176
CviKI_1 RGCY 3 cut(s) 17, 21, 176
Eco147I AGGCCT 1 cut(s) 176
Eco47I GGWCC 2 cut(s) 144, 154
EcoRII CCWGG 1 cut(s) 136
FaeI CATG 1 cut(s) 161
FaiI YATR 6 cut(s) 24, 36, 110, 159, 216, 267
FatI CATG 1 cut(s) 157
FspBI CTAG 2 cut(s) 18, 87
GsaI CCCAGC 1 cut(s) 30
HaeIII GGCC 1 cut(s) 176
Hin1II CATG 1 cut(s) 161
HphI GGTGA 1 cut(s) 293
Hpy188I TCNGA 1 cut(s) 181
HpyAV CCTTC 2 cut(s) 49, 67
HpyCH4V TGCA 3 cut(s) 43, 134, 161
HpyF10VI GCNNNNNNNGC 1 cut(s) 23
Hsp92II CATG 1 cut(s) 161
LpnPI CCDG 4 cut(s) 12, 123, 150, 158
LweI GCATC 1 cut(s) 30
MaeI CTAG 2 cut(s) 18, 87
MboII GAAGA 2 cut(s) 82, 89
MluCI AATT 1 cut(s) 166
MnlI CCTC 3 cut(s) 83, 135, 187
MseI TTAA 1 cut(s) 251
MspR9I CCNGG 1 cut(s) 138
MvaI CCWGG 1 cut(s) 138
MwoI GCNNNNNNNGC 1 cut(s) 23
NheI GCTAGC 1 cut(s) 17
NlaIII CATG 1 cut(s) 161
PceI AGGCCT 1 cut(s) 176
Psp6I CCWGG 1 cut(s) 136
PspFI CCCAGC 1 cut(s) 26
PspGI CCWGG 1 cut(s) 136
PspPI GGNCC 2 cut(s) 144, 154
SaqAI TTAA 1 cut(s) 251
Sau96I GGNCC 2 cut(s) 144, 154
ScrFI CCNGG 1 cut(s) 138
SetI ASST 5 cut(s) 23, 139, 156, 287, 306
SfaNI GCATC 1 cut(s) 30
SinI GGWCC 2 cut(s) 144, 154
Sse9I AATT 1 cut(s) 166
SseBI AGGCCT 1 cut(s) 176
SspMI CTAG 2 cut(s) 18, 87
StuI AGGCCT 1 cut(s) 176
StyD4I CCNGG 1 cut(s) 136
TasI AATT 1 cut(s) 166
Tru1I TTAA 1 cut(s) 251
Tru9I TTAA 1 cut(s) 251
VpaK11BI GGWCC 2 cut(s) 144, 154
XapI RAATTY 1 cut(s) 166
XspI CTAG 2 cut(s) 18, 87
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.