RchiOBHm_Chr7g0216891

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Forward (+)
34699438 .. 34699759
322 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ19409

Sequence Viewer

Length: 186 bp
ATGTGGTACAATGATGCATATAGCCAATGTAGTTTAATTCCTGGAATATTTATTGAAGCTCCTGCTGAAAGCTTCTGGGTGGATAAATATTTTGTGGATTCAAGTGTTGAGAACACTGAGTGCTTTGCTAGGGCAGTTGCCATATGGCAAGGAAAGAGAAATTCTGTTGAAAGCACTAGTATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

61

Amino Acids

6.96

Weight (kDa)

4.33

Isoelectric Point (pI)

43.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 160
AdeI CACNNNGTG 1 cut(s) 120
AfaI GTAC 1 cut(s) 8
AgsI TTSAA 3 cut(s) 56, 102, 170
AhlI ACTAGT 1 cut(s) 176
AjnI CCWGG 1 cut(s) 40
AluBI AGCT 2 cut(s) 59, 72
AluI AGCT 2 cut(s) 59, 72
ApoI RAATTY 1 cut(s) 160
BciT130I CCWGG 1 cut(s) 42
BcuI ACTAGT 1 cut(s) 176
BfaI CTAG 2 cut(s) 129, 177
Bme1390I CCNGG 1 cut(s) 42
BmrFI CCNGG 1 cut(s) 42
BmsI GCATC 1 cut(s) 4
BseBI CCWGG 1 cut(s) 42
BseMII CTCAG 1 cut(s) 108
BspCNI CTCAG 1 cut(s) 109
Bst2UI CCWGG 1 cut(s) 42
BstDEI CTNAG 1 cut(s) 117
BstNI CCWGG 1 cut(s) 42
BstSCI CCNGG 1 cut(s) 40
BtsIMutI CAGTG 1 cut(s) 114
Csp6I GTAC 1 cut(s) 7
CviJI RGCY 3 cut(s) 24, 59, 72
CviKI_1 RGCY 3 cut(s) 24, 59, 72
CviQI GTAC 1 cut(s) 7
DdeI CTNAG 1 cut(s) 117
DraIII CACNNNGTG 1 cut(s) 120
EcoRII CCWGG 1 cut(s) 40
EcoT22I ATGCAT 1 cut(s) 19
FaiI YATR 4 cut(s) 19, 21, 143, 145
FauNDI CATATG 1 cut(s) 143
FspBI CTAG 2 cut(s) 129, 177
HindIII AAGCTT 1 cut(s) 70
HinfI GANTC 1 cut(s) 98
HpyCH4V TGCA 1 cut(s) 17
HpyF3I CTNAG 1 cut(s) 117
LmnI GCTCC 1 cut(s) 64
LpnPI CCDG 4 cut(s) 27, 54, 61, 75
LweI GCATC 1 cut(s) 4
MaeI CTAG 2 cut(s) 129, 177
MluCI AATT 2 cut(s) 36, 160
Mph1103I ATGCAT 1 cut(s) 19
MseI TTAA 1 cut(s) 35
MspR9I CCNGG 1 cut(s) 42
MvaI CCWGG 1 cut(s) 42
NdeI CATATG 1 cut(s) 143
NsiI ATGCAT 1 cut(s) 19
PfeI GAWTC 1 cut(s) 98
PfoI TCCNGGA 1 cut(s) 40
Psp6I CCWGG 1 cut(s) 40
PspGI CCWGG 1 cut(s) 40
RsaI GTAC 1 cut(s) 8
RsaNI GTAC 1 cut(s) 7
SaqAI TTAA 1 cut(s) 35
ScrFI CCNGG 1 cut(s) 42
SetI ASST 2 cut(s) 61, 74
SfaNI GCATC 1 cut(s) 4
SgeI CNNG 7 cut(s) 53, 54, 74, 88, 114, 141, 161
SpeI ACTAGT 1 cut(s) 176
Sse9I AATT 2 cut(s) 36, 160
SspI AATATT 2 cut(s) 48, 89
SspMI CTAG 2 cut(s) 129, 177
StyD4I CCNGG 1 cut(s) 40
TasI AATT 2 cut(s) 36, 160
TfiI GAWTC 1 cut(s) 98
Tru1I TTAA 1 cut(s) 35
Tru9I TTAA 1 cut(s) 35
TscAI CASTG 1 cut(s) 121
TspRI CASTG 1 cut(s) 121
XapI RAATTY 1 cut(s) 160
XspI CTAG 2 cut(s) 129, 177
Zsp2I ATGCAT 1 cut(s) 19
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.