FvH4_2g02320

auxin-induced protein

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb2
Physical Location & Seq
Reverse (-)
1914341 .. 1915026
686 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_2g02320.t1

Sequence Viewer

Length: 387 bp
ATGGGTATCAAATTGTTATCAACCATCCGGCGATCTCTTATGAGGTCTAAGTTTTCAAGTTTGGCTACTACGAATGTCCCAAAGGGCCACTTTGCTGTTTATGTAGGGGAAGAACAGACAAAGAGATTCATAATACCAAAATCATACTTGAACCTACAGTGGTTCAGAGACGTGCTAAGTAATTCAAGTTCGTTTCCAATATCTGTTTCACCTGCAAGAGCTGATCTAGTACTACTTATCCTGGATGTTGAAATTGTTTGGTTCTTCAAAATCATTTTCCATTACGATTTCCAACTTAAGTTCCTAGTGTTCTTAAGGTCAGGTCCTTTTGCAGAGACACCCAAAAAACCAATGTGCAAGAAAAGACTACAATCACCTGATGGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

129

Amino Acids

14.77

Weight (kDa)

10.12

Isoelectric Point (pI)

56.09

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Auxin_inducible PF02519 16 - 63 3.8e-10 Auxin responsive protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 220
Acc36I ACCTGC 1 cut(s) 220
AfaI GTAC 1 cut(s) 231
AflII CTTAAG 2 cut(s) 296, 313
AgsI TTSAA 5 cut(s) 57, 151, 186, 251, 268
AjiI CACGTC 1 cut(s) 172
AjnI CCWGG 1 cut(s) 240
AjuI GAANNNNNNNTTGG 2 cut(s) 190, 222
AluBI AGCT 1 cut(s) 221
AluI AGCT 1 cut(s) 221
Alw26I GTCTC 2 cut(s) 162, 329
AoxI GGCC 1 cut(s) 85
AspS9I GGNCC 2 cut(s) 85, 323
AsuHPI GGTGA 2 cut(s) 201, 366
AvaII GGWCC 1 cut(s) 323
BccI CCATC 2 cut(s) 32, 374
BciT130I CCWGG 1 cut(s) 242
BcoDI GTCTC 2 cut(s) 162, 329
BfaI CTAG 2 cut(s) 227, 305
BfmI CTRYAG 1 cut(s) 155
BfrI CTTAAG 2 cut(s) 296, 313
BfuAI ACCTGC 1 cut(s) 220
BmcAI AGTACT 1 cut(s) 231
Bme1390I CCNGG 1 cut(s) 242
Bme18I GGWCC 1 cut(s) 323
BmgBI CACGTC 1 cut(s) 172
BmgT120I GGNCC 2 cut(s) 85, 323
BmrFI CCNGG 1 cut(s) 242
BseBI CCWGG 1 cut(s) 242
BseGI GGATG 2 cut(s) 24, 250
BshFI GGCC 1 cut(s) 87
BsiSI CCGG 1 cut(s) 28
BslFI GGGAC 1 cut(s) 62
BsmAI GTCTC 2 cut(s) 162, 329
BsmBI CGTCTC 1 cut(s) 162
BsmFI GGGAC 1 cut(s) 62
BsnI GGCC 1 cut(s) 87
Bsp143I GATC 2 cut(s) 32, 223
BspANI GGCC 1 cut(s) 87
BspMI ACCTGC 1 cut(s) 220
BspTI CTTAAG 2 cut(s) 296, 313
BssMI GATC 2 cut(s) 32, 223
Bst2UI CCWGG 1 cut(s) 242
Bst4CI ACNGT 1 cut(s) 159
BstAFI CTTAAG 2 cut(s) 296, 313
BstDEI CTNAG 2 cut(s) 48, 176
BstF5I GGATG 2 cut(s) 24, 250
BstKTI GATC 2 cut(s) 35, 226
BstMAI GTCTC 2 cut(s) 162, 329
BstMBI GATC 2 cut(s) 32, 223
BstNI CCWGG 1 cut(s) 242
BstSCI CCNGG 1 cut(s) 240
BstSFI CTRYAG 1 cut(s) 155
BsuRI GGCC 1 cut(s) 87
BtrI CACGTC 1 cut(s) 172
BtsCI GGATG 2 cut(s) 24, 250
BtsIMutI CAGTG 1 cut(s) 164
BveI ACCTGC 1 cut(s) 220
Cfr13I GGNCC 2 cut(s) 85, 323
Csp6I GTAC 1 cut(s) 230
CviJI RGCY 3 cut(s) 65, 87, 221
CviKI_1 RGCY 3 cut(s) 65, 87, 221
CviQI GTAC 1 cut(s) 230
DdeI CTNAG 2 cut(s) 48, 176
DpnI GATC 2 cut(s) 34, 225
DpnII GATC 2 cut(s) 32, 223
Eco47I GGWCC 1 cut(s) 323
EcoO109I RGGNCCY 1 cut(s) 323
EcoRII CCWGG 1 cut(s) 240
Esp3I CGTCTC 1 cut(s) 162
FaiI YATR 4 cut(s) 41, 102, 131, 145
FalI AAGNNNNNCTT 2 cut(s) 74, 106
FaqI GGGAC 1 cut(s) 62
FokI GGATG 2 cut(s) 11, 257
FspBI CTAG 2 cut(s) 227, 305
HaeIII GGCC 1 cut(s) 87
HapII CCGG 1 cut(s) 28
HinfI GANTC 1 cut(s) 126
HpaII CCGG 1 cut(s) 28
HphI GGTGA 2 cut(s) 201, 366
Hpy188I TCNGA 1 cut(s) 167
HpyCH4III ACNGT 1 cut(s) 159
HpyCH4IV ACGT 1 cut(s) 171
HpyCH4V TGCA 3 cut(s) 215, 332, 357
HpyF3I CTNAG 2 cut(s) 48, 176
HpySE526I ACGT 1 cut(s) 171
Kzo9I GATC 2 cut(s) 32, 223
LpnPI CCDG 5 cut(s) 41, 225, 227, 254, 306
MaeI CTAG 2 cut(s) 227, 305
MaeII ACGT 1 cut(s) 171
MalI GATC 2 cut(s) 34, 225
MboI GATC 2 cut(s) 32, 223
MboII GAAGA 2 cut(s) 122, 256
MluCI AATT 3 cut(s) 11, 181, 252
MmeI TCCRAC 1 cut(s) 316
MnlI CCTC 1 cut(s) 36
MseI TTAA 3 cut(s) 297, 314, 385
MspCI CTTAAG 2 cut(s) 296, 313
MspI CCGG 1 cut(s) 28
MspR9I CCNGG 1 cut(s) 242
MvaI CCWGG 1 cut(s) 242
NdeII GATC 2 cut(s) 32, 223
PaqCI CACCTGC 1 cut(s) 220
PfeI GAWTC 1 cut(s) 126
PfoI TCCNGGA 1 cut(s) 240
PpuMI RGGWCCY 1 cut(s) 323
Psp5II RGGWCCY 1 cut(s) 323
Psp6I CCWGG 1 cut(s) 240
PspGI CCWGG 1 cut(s) 240
PspPI GGNCC 2 cut(s) 85, 323
PspPPI RGGWCCY 1 cut(s) 323
PsrI GAACNNNNNNTAC 2 cut(s) 172, 204
RsaI GTAC 1 cut(s) 231
RsaNI GTAC 1 cut(s) 230
SaqAI TTAA 3 cut(s) 297, 314, 385
Sau3AI GATC 2 cut(s) 32, 223
Sau96I GGNCC 2 cut(s) 85, 323
ScaI AGTACT 1 cut(s) 231
ScrFI CCNGG 1 cut(s) 242
SetI ASST 8 cut(s) 47, 156, 174, 214, 223, 320, 325, 379
SfcI CTRYAG 1 cut(s) 155
SinI GGWCC 1 cut(s) 323
SmlI CTYRAG 2 cut(s) 296, 313
SmoI CTYRAG 2 cut(s) 296, 313
Sse9I AATT 3 cut(s) 11, 181, 252
SspMI CTAG 2 cut(s) 227, 305
StyD4I CCNGG 1 cut(s) 240
TaaI ACNGT 1 cut(s) 159
TaiI ACGT 1 cut(s) 174
TasI AATT 3 cut(s) 11, 181, 252
TatI WGTACW 1 cut(s) 229
TfiI GAWTC 1 cut(s) 126
Tru1I TTAA 3 cut(s) 297, 314, 385
Tru9I TTAA 3 cut(s) 297, 314, 385
TscAI CASTG 1 cut(s) 164
TspDTI ATGAA 1 cut(s) 118
TspRI CASTG 1 cut(s) 164
Vha464I CTTAAG 2 cut(s) 296, 313
VpaK11BI GGWCC 1 cut(s) 323
XspI CTAG 2 cut(s) 227, 305
ZrmI AGTACT 1 cut(s) 231
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.