MD05G1113200.v1.1

auxin-induced protein

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr05
Physical Location & Seq
Forward (+)
23165138 .. 23165296
159 bp
Loading structure...
UTR
Exon/CDS
Intron
MD05G1113200.v1.1.491

Sequence Viewer

Length: 159 bp
ATGGGTTTGAGCTTGCTATCAATCATCCGGCGATCTTTCTTGACGGGTAAGCAATCGAGGATAAGTACAGCGAATGTCCCAAAAGGCCACTTTGCTGTATATGTAGGAGAGGAGCAGAAGAAGAGACTTGTAGTACCAATATCATACTTGATCCACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

53

Amino Acids

5.84

Weight (kDa)

10.62

Isoelectric Point (pI)

60.57

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Auxin_inducible PF02519 17 - 52 6.4e-08 Auxin responsive protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 145
AfaI GTAC 2 cut(s) 67, 135
AluBI AGCT 1 cut(s) 12
AluI AGCT 1 cut(s) 12
Alw26I GTCTC 1 cut(s) 118
AlwI GGATC 1 cut(s) 145
AoxI GGCC 1 cut(s) 85
BcoDI GTCTC 1 cut(s) 118
BfaI CTAG 1 cut(s) 157
BseGI GGATG 1 cut(s) 24
BseRI GAGGAG 1 cut(s) 125
BshFI GGCC 1 cut(s) 87
BsiSI CCGG 1 cut(s) 28
BslFI GGGAC 1 cut(s) 62
BsmAI GTCTC 1 cut(s) 118
BsmFI GGGAC 1 cut(s) 62
BsnI GGCC 1 cut(s) 87
Bsp143I GATC 2 cut(s) 32, 150
BspANI GGCC 1 cut(s) 87
BspPI GGATC 1 cut(s) 145
BssMI GATC 2 cut(s) 32, 150
Bst6I CTCTTC 1 cut(s) 116
BstC8I GCNNGC 1 cut(s) 14
BstF5I GGATG 1 cut(s) 24
BstKTI GATC 2 cut(s) 35, 153
BstMAI GTCTC 1 cut(s) 118
BstMBI GATC 2 cut(s) 32, 150
BsuRI GGCC 1 cut(s) 87
BtsCI GGATG 1 cut(s) 24
Cac8I GCNNGC 1 cut(s) 14
Csp6I GTAC 2 cut(s) 66, 134
CviJI RGCY 2 cut(s) 12, 87
CviKI_1 RGCY 2 cut(s) 12, 87
CviQI GTAC 2 cut(s) 66, 134
DpnI GATC 2 cut(s) 34, 152
DpnII GATC 2 cut(s) 32, 150
Eam1104I CTCTTC 1 cut(s) 116
EarI CTCTTC 1 cut(s) 116
FaiI YATR 3 cut(s) 100, 102, 145
FaqI GGGAC 1 cut(s) 62
FokI GGATG 1 cut(s) 11
FspBI CTAG 1 cut(s) 157
HaeIII GGCC 1 cut(s) 87
HapII CCGG 1 cut(s) 28
HpaII CCGG 1 cut(s) 28
Hpy188III TCNNGA 1 cut(s) 40
Kzo9I GATC 2 cut(s) 32, 150
LmnI GCTCC 1 cut(s) 112
LpnPI CCDG 1 cut(s) 41
MaeI CTAG 1 cut(s) 157
MalI GATC 2 cut(s) 34, 152
MboI GATC 2 cut(s) 32, 150
MboII GAAGA 2 cut(s) 130, 133
MnlI CCTC 2 cut(s) 51, 103
MspI CCGG 1 cut(s) 28
NdeII GATC 2 cut(s) 32, 150
RsaI GTAC 2 cut(s) 67, 135
RsaNI GTAC 2 cut(s) 66, 134
Sau3AI GATC 2 cut(s) 32, 150
SetI ASST 1 cut(s) 14
SgeI CNNG 6 cut(s) 25, 40, 52, 57, 69, 140
SspMI CTAG 1 cut(s) 157
TaqI TCGA 1 cut(s) 56
TatI WGTACW 1 cut(s) 65
XspI CTAG 1 cut(s) 157
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.