RchiOBHm_Chr6g0246071

auxin-induced protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
OG0014651
Physical Location & Seq
Reverse (-)
1770278 .. 1771477
1200 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ22057

Sequence Viewer

Length: 162 bp
ATGGGTATCAAATTGTTATCACCCATCCGAAGATCTCTGCATCTGGCTAAGCAATTGAGTATGCCTACTTCAAAAGTCCCAAAGGGCCACTTTGCTGTTTCTGCAGAAGAAGAACAGAAAAAGAGATTCATAATACCAATATTATACTTGAACCAACAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04075 map04075
Pfam Domains
Protein Families
Auxin_inducible

Protein Analysis

53

Amino Acids

6.07

Weight (kDa)

10.38

Isoelectric Point (pI)

71.01

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Auxin_inducible PF02519 16 - 52 3.3e-06 Auxin responsive protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 72, 151
AoxI GGCC 1 cut(s) 85
AspS9I GGNCC 1 cut(s) 85
AsuHPI GGTGA 1 cut(s) 12
BarI GAAGNNNNNNTAC 2 cut(s) 52, 84
BccI CCATC 1 cut(s) 32
BfmI CTRYAG 1 cut(s) 102
BglII AGATCT 1 cut(s) 32
BlpI GCTNAGC 1 cut(s) 48
BmgT120I GGNCC 1 cut(s) 85
BmsI GCATC 1 cut(s) 49
Bpu1102I GCTNAGC 1 cut(s) 48
BseGI GGATG 1 cut(s) 24
BshFI GGCC 1 cut(s) 87
BslFI GGGAC 1 cut(s) 62
BsmFI GGGAC 1 cut(s) 62
BsnI GGCC 1 cut(s) 87
Bsp143I GATC 1 cut(s) 32
Bsp1720I GCTNAGC 1 cut(s) 48
BspANI GGCC 1 cut(s) 87
BspMAI CTGCAG 1 cut(s) 106
BssMI GATC 1 cut(s) 32
Bst4CI ACNGT 1 cut(s) 159
BstDEI CTNAG 1 cut(s) 48
BstF5I GGATG 1 cut(s) 24
BstKTI GATC 1 cut(s) 35
BstMBI GATC 1 cut(s) 32
BstMWI GCNNNNNNNGC 1 cut(s) 101
BstSFI CTRYAG 1 cut(s) 102
BstX2I RGATCY 1 cut(s) 32
BstYI RGATCY 1 cut(s) 32
BsuRI GGCC 1 cut(s) 87
BtsCI GGATG 1 cut(s) 24
Cfr13I GGNCC 1 cut(s) 85
CviJI RGCY 2 cut(s) 47, 87
CviKI_1 RGCY 2 cut(s) 47, 87
DdeI CTNAG 1 cut(s) 48
DpnI GATC 1 cut(s) 34
DpnII GATC 1 cut(s) 32
FaiI YATR 3 cut(s) 62, 131, 145
FalI AAGNNNNNCTT 2 cut(s) 74, 106
FaqI GGGAC 1 cut(s) 62
FokI GGATG 1 cut(s) 11
HaeIII GGCC 1 cut(s) 87
HinfI GANTC 1 cut(s) 126
HphI GGTGA 1 cut(s) 12
Hpy188I TCNGA 1 cut(s) 29
HpyCH4III ACNGT 1 cut(s) 159
HpyCH4V TGCA 2 cut(s) 40, 104
HpyF10VI GCNNNNNNNGC 1 cut(s) 101
HpyF3I CTNAG 1 cut(s) 48
Kzo9I GATC 1 cut(s) 32
LpnPI CCDG 1 cut(s) 29
LweI GCATC 1 cut(s) 49
MalI GATC 1 cut(s) 34
MboI GATC 1 cut(s) 32
MboII GAAGA 3 cut(s) 42, 119, 122
MfeI CAATTG 1 cut(s) 53
MflI RGATCY 1 cut(s) 32
MluCI AATT 2 cut(s) 11, 53
MunI CAATTG 1 cut(s) 53
MwoI GCNNNNNNNGC 1 cut(s) 101
NdeII GATC 1 cut(s) 32
PfeI GAWTC 1 cut(s) 126
PspPI GGNCC 1 cut(s) 85
PstI CTGCAG 1 cut(s) 106
PsuI RGATCY 1 cut(s) 32
Sau3AI GATC 1 cut(s) 32
Sau96I GGNCC 1 cut(s) 85
SfaNI GCATC 1 cut(s) 49
SfcI CTRYAG 1 cut(s) 102
SgeI CNNG 1 cut(s) 56
Sse9I AATT 2 cut(s) 11, 53
SspI AATATT 1 cut(s) 141
TaaI ACNGT 1 cut(s) 159
TasI AATT 2 cut(s) 11, 53
TfiI GAWTC 1 cut(s) 126
TspDTI ATGAA 1 cut(s) 118
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.