Rroxscaffold_7G00214980

auxin-induced protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
OG0014651
Physical Location & Seq
Forward (+)
65616030 .. 65616317
288 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00214980.1

Sequence Viewer

Length: 288 bp
ATGGGTATCAAATTGCTATCAACTATTCGGCGATCTCTACTGGCGTCTAAGCTTTCAAGTGTGGCTACTACGAATGTCCCAAAGGGCCACTTGGCTGTTTATGTAGGGGAAGAACAGAAAAAGAGATTCATCATACCAGTATCATACTTGAACCACCAGTGGTTCAAAGAGTTGCTAAATTTTTCTGAAGAGAAATTTGGATTCACTCATCCAATGGGTGGTATCACTATTCCATGCACTGAGGAGGCCTTCATTGGTTTCAGTCGTTCTTGTTTACATTCCTTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04075 map04075
Pfam Domains
Protein Families
Auxin_inducible

Protein Analysis

95

Amino Acids

10.68

Weight (kDa)

9.34

Isoelectric Point (pI)

48.2

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Auxin_inducible PF02519 17 - 84 3.8e-23 Auxin responsive protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 218
AcsI RAATTY 2 cut(s) 178, 194
AcuI CTGAAG 1 cut(s) 207
AcyI GRCGYC 1 cut(s) 44
AfiI CCNNNNNNNGG 1 cut(s) 218
AgsI TTSAA 3 cut(s) 57, 151, 166
AjuI GAANNNNNNNTTGG 2 cut(s) 180, 212
AluBI AGCT 1 cut(s) 52
AluI AGCT 1 cut(s) 52
AoxI GGCC 2 cut(s) 85, 246
ApoI RAATTY 2 cut(s) 178, 194
AspS9I GGNCC 1 cut(s) 85
BmgT120I GGNCC 1 cut(s) 85
BsaHI GRCGYC 1 cut(s) 44
Bsc4I CCNNNNNNNGG 1 cut(s) 218
Bse1I ACTGG 3 cut(s) 45, 137, 157
BseGI GGATG 1 cut(s) 208
BseLI CCNNNNNNNGG 1 cut(s) 218
BseMII CTCAG 1 cut(s) 231
BseNI ACTGG 3 cut(s) 45, 137, 157
BseRI GAGGAG 1 cut(s) 257
BshFI GGCC 2 cut(s) 87, 248
BslFI GGGAC 1 cut(s) 62
BslI CCNNNNNNNGG 1 cut(s) 218
BsmFI GGGAC 1 cut(s) 62
BsnI GGCC 2 cut(s) 87, 248
Bsp143I GATC 1 cut(s) 32
BspANI GGCC 2 cut(s) 87, 248
BspCNI CTCAG 1 cut(s) 232
BsrI ACTGG 3 cut(s) 45, 137, 157
BssMI GATC 1 cut(s) 32
BssNI GRCGYC 1 cut(s) 44
Bst6I CTCTTC 1 cut(s) 183
BstACI GRCGYC 1 cut(s) 44
BstDEI CTNAG 2 cut(s) 48, 240
BstF5I GGATG 1 cut(s) 208
BstKTI GATC 1 cut(s) 35
BstMBI GATC 1 cut(s) 32
BsuRI GGCC 2 cut(s) 87, 248
BtsCI GGATG 1 cut(s) 208
BtsIMutI CAGTG 2 cut(s) 164, 237
Cfr13I GGNCC 1 cut(s) 85
CseI GACGC 1 cut(s) 33
CviAII CATG 1 cut(s) 234
CviJI RGCY 5 cut(s) 52, 65, 87, 95, 248
CviKI_1 RGCY 5 cut(s) 52, 65, 87, 95, 248
DdeI CTNAG 2 cut(s) 48, 240
DpnI GATC 1 cut(s) 34
DpnII GATC 1 cut(s) 32
Eam1104I CTCTTC 1 cut(s) 183
EarI CTCTTC 1 cut(s) 183
Eco147I AGGCCT 1 cut(s) 248
Eco57I CTGAAG 1 cut(s) 207
FaeI CATG 1 cut(s) 237
FaiI YATR 4 cut(s) 102, 134, 145, 235
FalI AAGNNNNNCTT 2 cut(s) 74, 106
FaqI GGGAC 1 cut(s) 62
FatI CATG 1 cut(s) 233
FokI GGATG 1 cut(s) 195
HaeIII GGCC 2 cut(s) 87, 248
HgaI GACGC 1 cut(s) 33
Hin1I GRCGYC 1 cut(s) 44
Hin1II CATG 1 cut(s) 237
HindIII AAGCTT 1 cut(s) 50
HinfI GANTC 2 cut(s) 126, 201
Hpy166II GTNNAC 1 cut(s) 275
Hpy188I TCNGA 1 cut(s) 187
Hpy8I GTNNAC 1 cut(s) 275
HpyAV CCTTC 1 cut(s) 259
HpyCH4V TGCA 1 cut(s) 237
HpyF3I CTNAG 2 cut(s) 48, 240
Hsp92I GRCGYC 1 cut(s) 44
Hsp92II CATG 1 cut(s) 237
Kzo9I GATC 1 cut(s) 32
LpnPI CCDG 3 cut(s) 26, 150, 170
MalI GATC 1 cut(s) 34
MboI GATC 1 cut(s) 32
MboII GAAGA 2 cut(s) 122, 200
MluCI AATT 3 cut(s) 11, 178, 194
MnlI CCTC 2 cut(s) 235, 238
NdeII GATC 1 cut(s) 32
NlaIII CATG 1 cut(s) 237
PceI AGGCCT 1 cut(s) 248
PfeI GAWTC 2 cut(s) 126, 201
PflMI CCANNNNNTGG 1 cut(s) 218
PspPI GGNCC 1 cut(s) 85
Sau3AI GATC 1 cut(s) 32
Sau96I GGNCC 1 cut(s) 85
SetI ASST 1 cut(s) 54
SgeI CNNG 8 cut(s) 53, 69, 103, 149, 160, 169, 246, 282
Sse9I AATT 3 cut(s) 11, 178, 194
SseBI AGGCCT 1 cut(s) 248
StuI AGGCCT 1 cut(s) 248
TasI AATT 3 cut(s) 11, 178, 194
TfiI GAWTC 2 cut(s) 126, 201
TscAI CASTG 2 cut(s) 164, 244
TspDTI ATGAA 2 cut(s) 118, 241
TspRI CASTG 2 cut(s) 164, 244
Van91I CCANNNNNTGG 1 cut(s) 218
XapI RAATTY 2 cut(s) 178, 194
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.