Basic Information

Type: gene

Biological Identity

Species

fragaria_vesca

Chromosome

Fvb2

Orthogroup ID

OG0013809

Physical Location & Seq

Genomic Coordinates Reverse (-)

19531187 .. 19535236

Gene Structure 4050 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

FvH4_2g23900.t1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 516 bp

ATGGGTGCTACGCAGTCGTGCCTCACCGAGCAATCAATCCACGAATTCATTGTCAAGGACACCAAAGGCAATGACGTCGACCTCAGCATTTACAAAGGGAAGGTCCTCCTGGTCGTCAACGTCGCTTCCAAATGCGGTTTTACAGATACGAATTACACACAGCTGACTGAGCTCTACGGCAAATACAAGGACAAAGGTTTTGAGGTCCTGGCGTTTCCATGCAATCAGTTTCTGAAGCAAGAGCCTGGAACAAGCACGGATGCGGTTGAATTTGCATGTACAAGGTACAAGGCTGAATATCCGATCTTCAAGAAGATACGTGTGAATGGGCCAAACACAGAACCTGTGTACAAATTCCTCAAAGCAAGTAAACCTGGATTTTTGGGGAGTAGGATAAAGTGGAACTTCACTAAGTTCTTAGTTAACAAGGATGGCATTGTCATCGGACGTTACAGCCCAACCACCTCTCCCTTGAGTATTGAGGCTGACATCAAAAAAGCACTAGGAGAGGTATAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044464

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

CTD_bind GSHPx PWWP

Protein Analysis

172

Amino Acids

19.1

Weight (kDa)

9.06

Isoelectric Point (pI)

24.84

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
AhpC-TSA	PF00578	11 - 76	1.1e-07	AhpC/TSA family
GSHPx	PF00255	13 - 121	5.8e-40	Glutathione peroxidase
Redoxin	PF08534	13 - 83	2e-07	Redoxin

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013809)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G48150 AT2G48150 AT3G63080
fragaria_vesca	FvH4_2g23900
malus_domestica	MD03G1268500.v1.1 MD11G1289300.v1.1
prunus_persica	Prupe.8G244300_v2.0.a1
pyrus_communis	pycom11g25670
rosa_chinensis	RchiOBHm_Chr6g0291511
rosa_laevigata	RLG00000012110
rosa_multiflora	Rmu_sc0026626.1_g000001
rosa_roxburghii	Rroxscaffold_7G00176010
rosa_rugosa	Rorug06G0220100
rosa_samantha	Rh6AG332200 Rh6BG339100 Rh6CG345300 Rh6DG332700

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AatII	GACGTC	1 cut(s)	78
AccI	GTMKAC	1 cut(s)	78
AciI	CCGC	2 cut(s)	135, 263
AcsI	RAATTY	3 cut(s)	44, 269, 353
AcuI	CTGAAG	1 cut(s)	254
AcyI	GRCGYC	1 cut(s)	75
AfaI	GTAC	3 cut(s)	280, 287, 350
AflIII	ACRYGT	1 cut(s)	319
AgsI	TTSAA	2 cut(s)	269, 310
AjnI	CCWGG	4 cut(s)	108, 207, 244, 373
AluBI	AGCT	2 cut(s)	163, 172
AluI	AGCT	2 cut(s)	163, 172
Alw21I	GWGCWC	1 cut(s)	174
AlwNI	CAGNNNCTG	2 cut(s)	232, 344
AoxI	GGCC	1 cut(s)	329
ApoI	RAATTY	3 cut(s)	44, 269, 353
ArsI	GACNNNNNNTTYG	6 cut(s)	36, 68, 87, 119, 182, 214
AspS9I	GGNCC	3 cut(s)	103, 205, 329
AsuHPI	GGTGA	1 cut(s)	16
AvaII	GGWCC	2 cut(s)	103, 205
BanII	GRGCYC	1 cut(s)	174
Bbv12I	GWGCWC	1 cut(s)	174
BbvCI	CCTCAGC	1 cut(s)	83
BccI	CCATC	1 cut(s)	425
BceAI	ACGGC	1 cut(s)	193
BcgI	CGANNNNNNTGC	4 cut(s)	58, 92, 424, 458
BciT130I	CCWGG	4 cut(s)	110, 209, 246, 375
BfaI	CTAG	1 cut(s)	503
Bme1390I	CCNGG	4 cut(s)	110, 209, 246, 375
Bme18I	GGWCC	2 cut(s)	103, 205
BmgT120I	GGNCC	3 cut(s)	103, 205, 329
BmrFI	CCNGG	4 cut(s)	110, 209, 246, 375
BmsI	GCATC	1 cut(s)	250
Bpu10I	CCTNAGC	1 cut(s)	83
BpuEI	CTTGAG	1 cut(s)	493
BsaAI	YACGTR	1 cut(s)	320
BsaHI	GRCGYC	1 cut(s)	75
BsaXI	ACNNNNNCTCC	2 cut(s)	451, 481
Bse3DI	GCAATG	1 cut(s)	76
BseBI	CCWGG	4 cut(s)	110, 209, 246, 375
BseGI	GGATG	2 cut(s)	265, 436
BseMI	GCAATG	1 cut(s)	76
BseMII	CTCAG	2 cut(s)	97, 159
BshFI	GGCC	1 cut(s)	331
BsiHKAI	GWGCWC	1 cut(s)	174
BsnI	GGCC	1 cut(s)	331
Bsp1286I	GDGCHC	1 cut(s)	174
Bsp1407I	TGTACA	2 cut(s)	278, 348
Bsp143I	GATC	1 cut(s)	303
BspACI	CCGC	2 cut(s)	135, 263
BspANI	GGCC	1 cut(s)	331
BspCNI	CTCAG	2 cut(s)	96, 160
BsrDI	GCAATG	1 cut(s)	76
BsrGI	TGTACA	2 cut(s)	278, 348
BssMI	GATC	1 cut(s)	303
BssNI	GRCGYC	1 cut(s)	75
Bst2UI	CCWGG	4 cut(s)	110, 209, 246, 375
BstACI	GRCGYC	1 cut(s)	75
BstAUI	TGTACA	2 cut(s)	278, 348
BstBAI	YACGTR	1 cut(s)	320
BstDEI	CTNAG	4 cut(s)	83, 168, 411, 418
BstF5I	GGATG	2 cut(s)	265, 436
BstKTI	GATC	1 cut(s)	306
BstMBI	GATC	1 cut(s)	303
BstMWI	GCNNNNNNNGC	1 cut(s)	169
BstNI	CCWGG	4 cut(s)	110, 209, 246, 375
BstNSI	RCATGY	1 cut(s)	279
BstSCI	CCNGG	4 cut(s)	108, 207, 244, 373
BsuRI	GGCC	1 cut(s)	331
BtsCI	GGATG	2 cut(s)	265, 436
CaiI	CAGNNNCTG	2 cut(s)	232, 344
Cfr13I	GGNCC	3 cut(s)	103, 205, 329
Csp6I	GTAC	3 cut(s)	279, 286, 349
CviAII	CATG	2 cut(s)	219, 276
CviJI	RGCY	7 cut(s)	163, 172, 244, 293, 331, 456, 485
CviKI_1	RGCY	7 cut(s)	163, 172, 244, 293, 331, 456, 485
CviQI	GTAC	3 cut(s)	279, 286, 349
DdeI	CTNAG	4 cut(s)	83, 168, 411, 418
DpnI	GATC	1 cut(s)	305
DpnII	GATC	1 cut(s)	303
Ecl136II	GAGCTC	1 cut(s)	172
Eco24I	GRGCYC	1 cut(s)	174
Eco47I	GGWCC	2 cut(s)	103, 205
Eco53kI	GAGCTC	1 cut(s)	172
Eco57I	CTGAAG	1 cut(s)	254
EcoICRI	GAGCTC	1 cut(s)	172
EcoO109I	RGGNCCY	2 cut(s)	103, 205
EcoRI	GAATTC	1 cut(s)	44
EcoRII	CCWGG	4 cut(s)	108, 207, 244, 373
EcoT38I	GRGCYC	1 cut(s)	174
FaeI	CATG	2 cut(s)	222, 279
FaiI	YATR	3 cut(s)	220, 277, 514
FalI	AAGNNNNNCTT	2 cut(s)	389, 421
FatI	CATG	2 cut(s)	218, 275
FblI	GTMKAC	1 cut(s)	78
FokI	GGATG	2 cut(s)	272, 443
FriOI	GRGCYC	1 cut(s)	174
FspBI	CTAG	1 cut(s)	503
HaeIII	GGCC	1 cut(s)	331
Hin1I	GRCGYC	1 cut(s)	75
Hin1II	CATG	2 cut(s)	222, 279
HincII	GTYRAC	3 cut(s)	79, 118, 424
HindII	GTYRAC	3 cut(s)	79, 118, 424
HpaI	GTTAAC	1 cut(s)	424
HphI	GGTGA	1 cut(s)	16
Hpy166II	GTNNAC	5 cut(s)	79, 118, 349, 371, 424
Hpy188I	TCNGA	3 cut(s)	234, 303, 446
Hpy188III	TCNNGA	1 cut(s)	310
Hpy8I	GTNNAC	5 cut(s)	79, 118, 349, 371, 424
Hpy99I	CGWCG	2 cut(s)	80, 125
HpyAV	CCTTC	1 cut(s)	94
HpyCH4IV	ACGT	4 cut(s)	75, 120, 319, 448
HpyCH4V	TGCA	2 cut(s)	222, 275
HpyF10VI	GCNNNNNNNGC	1 cut(s)	169
HpyF3I	CTNAG	4 cut(s)	83, 168, 411, 418
HpySE526I	ACGT	4 cut(s)	75, 120, 319, 448
Hsp92I	GRCGYC	1 cut(s)	75
Hsp92II	CATG	2 cut(s)	222, 279
KspAI	GTTAAC	1 cut(s)	424
Kzo9I	GATC	1 cut(s)	303
LpnPI	CCDG	9 cut(s)	95, 122, 194, 221, 231, 258, 357, 360, 387
LweI	GCATC	1 cut(s)	250
MaeI	CTAG	1 cut(s)	503
MaeII	ACGT	4 cut(s)	75, 120, 319, 448
MaeIII	GTNAC	1 cut(s)	449
MalI	GATC	1 cut(s)	305
MboI	GATC	1 cut(s)	303
MboII	GAAGA	2 cut(s)	298, 325
MhlI	GDGCHC	1 cut(s)	174
MluCI	AATT	4 cut(s)	44, 151, 269, 353
MnlI	CCTC	8 cut(s)	32, 92, 116, 196, 368, 475, 475, 502
MseI	TTAA	1 cut(s)	423
MspA1I	CMGCKG	1 cut(s)	163
MspR9I	CCNGG	4 cut(s)	110, 209, 246, 375
MvaI	CCWGG	4 cut(s)	110, 209, 246, 375
MwoI	GCNNNNNNNGC	1 cut(s)	169
NdeII	GATC	1 cut(s)	303
NlaIII	CATG	2 cut(s)	222, 279
NspI	RCATGY	1 cut(s)	279
Ppu21I	YACGTR	1 cut(s)	320
PpuMI	RGGWCCY	2 cut(s)	103, 205
Psp124BI	GAGCTC	1 cut(s)	174
Psp5II	RGGWCCY	2 cut(s)	103, 205
Psp6I	CCWGG	4 cut(s)	108, 207, 244, 373
PspGI	CCWGG	4 cut(s)	108, 207, 244, 373
PspPI	GGNCC	3 cut(s)	103, 205, 329
PspPPI	RGGWCCY	2 cut(s)	103, 205
PstNI	CAGNNNCTG	2 cut(s)	232, 344
PvuII	CAGCTG	1 cut(s)	163
RsaI	GTAC	3 cut(s)	280, 287, 350
RsaNI	GTAC	3 cut(s)	279, 286, 349
SacI	GAGCTC	1 cut(s)	174
SalI	GTCGAC	1 cut(s)	77
SaqAI	TTAA	1 cut(s)	423
Sau3AI	GATC	1 cut(s)	303
Sau96I	GGNCC	3 cut(s)	103, 205, 329
ScrFI	CCNGG	4 cut(s)	110, 209, 246, 375
SduI	GDGCHC	1 cut(s)	174
SfaNI	GCATC	1 cut(s)	250
SinI	GGWCC	2 cut(s)	103, 205
SmlI	CTYRAG	1 cut(s)	472
SmoI	CTYRAG	1 cut(s)	472
Sse9I	AATT	4 cut(s)	44, 151, 269, 353
SsiI	CCGC	2 cut(s)	135, 263
SspMI	CTAG	1 cut(s)	503
SstI	GAGCTC	1 cut(s)	174
StyD4I	CCNGG	4 cut(s)	108, 207, 244, 373
TaiI	ACGT	4 cut(s)	78, 123, 322, 451
TaqI	TCGA	1 cut(s)	78
TasI	AATT	4 cut(s)	44, 151, 269, 353
TatI	WGTACW	2 cut(s)	278, 348
Tru1I	TTAA	1 cut(s)	423
Tru9I	TTAA	1 cut(s)	423
TspDTI	ATGAA	1 cut(s)	37
TspGWI	ACGGA	1 cut(s)	272
VpaK11BI	GGWCC	2 cut(s)	103, 205
XapI	RAATTY	3 cut(s)	44, 269, 353
XceI	RCATGY	1 cut(s)	279
XmiI	GTMKAC	1 cut(s)	78
XspI	CTAG	1 cut(s)	503
ZraI	GACGTC	1 cut(s)	76

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.