Rh6DG332700

Belongs to the glutathione peroxidase family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
Physical Location & Seq
Reverse (-)
53769765 .. 53775225
5461 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG332700.1

Sequence Viewer

Length: 402 bp
ATGGGTGCTACACACTCGTCGTGCCTCTCCGAAAAATCCATCCACGAATTCACAGTCAAGGATAGCAAAGGCAAGGACGTCGACCTCAGCGTTTACAAAGGGAAGGTCCTCCTCGTGGTTAACGTCGCTTCCAAATGTGGCTTTACCGATACCAATTACACACAGTTGACTGAGCTTTACAGCAAATACAAGGACAAAGGTTTTGAGGTCTTGGCATTTCCATGCAACCAGTTTCTGAAGCAGGAGCCTGGAACAAGCCTGGATGCGATTGAATTTGTATGTACAAGGTACAAGGCTGAATATCCAATCTTCAAGAAGGTAGTTGAATATCTCTTACCATATCATATTTATCAGCTAGTCAATGAGATTATTCTATTTCAATCTGGTGCTTCATGCTTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

133

Amino Acids

15.06

Weight (kDa)

6.81

Isoelectric Point (pI)

32.69

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Redoxin PF08534 12 - 73 5.3e-08 Redoxin
GSHPx PF00255 14 - 107 1e-32 Glutathione peroxidase
AhpC-TSA PF00578 14 - 76 1.5e-08 AhpC/TSA family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013809)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 81
AccI GTMKAC 1 cut(s) 81
AcsI RAATTY 2 cut(s) 47, 272
AcuI CTGAAG 1 cut(s) 257
AcyI GRCGYC 1 cut(s) 78
AfaI GTAC 2 cut(s) 283, 290
AfiI CCNNNNNNNGG 1 cut(s) 115
AgsI TTSAA 4 cut(s) 272, 313, 326, 380
AjnI CCWGG 2 cut(s) 247, 258
AluBI AGCT 2 cut(s) 175, 355
AluI AGCT 2 cut(s) 175, 355
AlwNI CAGNNNCTG 1 cut(s) 235
ApoI RAATTY 2 cut(s) 47, 272
ArsI GACNNNNNNTTYG 6 cut(s) 39, 71, 90, 122, 185, 217
AspS9I GGNCC 1 cut(s) 106
AvaII GGWCC 1 cut(s) 106
BauI CACGAG 1 cut(s) 113
BbvCI CCTCAGC 1 cut(s) 86
BccI CCATC 1 cut(s) 47
BcgI CGANNNNNNTGC 2 cut(s) 61, 95
BciT130I CCWGG 2 cut(s) 249, 260
BfaI CTAG 1 cut(s) 356
Bme1390I CCNGG 2 cut(s) 249, 260
Bme18I GGWCC 1 cut(s) 106
BmgT120I GGNCC 1 cut(s) 106
BmiI GGNNCC 1 cut(s) 246
BmrFI CCNGG 2 cut(s) 249, 260
BmsI GCATC 1 cut(s) 253
Bpu10I CCTNAGC 1 cut(s) 86
BsaHI GRCGYC 1 cut(s) 78
Bsc4I CCNNNNNNNGG 1 cut(s) 115
Bse1I ACTGG 1 cut(s) 229
BseBI CCWGG 2 cut(s) 249, 260
BseGI GGATG 2 cut(s) 39, 268
BseLI CCNNNNNNNGG 1 cut(s) 115
BseMII CTCAG 2 cut(s) 100, 162
BseNI ACTGG 1 cut(s) 229
BseRI GAGGAG 1 cut(s) 101
BslI CCNNNNNNNGG 1 cut(s) 115
Bsp1407I TGTACA 1 cut(s) 281
BspCNI CTCAG 2 cut(s) 99, 163
BspLI GGNNCC 1 cut(s) 246
BsrGI TGTACA 1 cut(s) 281
BsrI ACTGG 1 cut(s) 229
BssNI GRCGYC 1 cut(s) 78
BssSI CACGAG 1 cut(s) 113
Bst2BI CACGAG 1 cut(s) 113
Bst2UI CCWGG 2 cut(s) 249, 260
Bst4CI ACNGT 2 cut(s) 55, 165
BstACI GRCGYC 1 cut(s) 78
BstAUI TGTACA 1 cut(s) 281
BstDEI CTNAG 2 cut(s) 86, 171
BstF5I GGATG 2 cut(s) 39, 268
BstNI CCWGG 2 cut(s) 249, 260
BstSCI CCNGG 2 cut(s) 247, 258
BtsCI GGATG 2 cut(s) 39, 268
CaiI CAGNNNCTG 1 cut(s) 235
Cfr13I GGNCC 1 cut(s) 106
Csp6I GTAC 2 cut(s) 282, 289
CviAII CATG 2 cut(s) 222, 393
CviJI RGCY 6 cut(s) 141, 175, 247, 258, 296, 355
CviKI_1 RGCY 6 cut(s) 141, 175, 247, 258, 296, 355
CviQI GTAC 2 cut(s) 282, 289
DdeI CTNAG 2 cut(s) 86, 171
Eco47I GGWCC 1 cut(s) 106
Eco57I CTGAAG 1 cut(s) 257
EcoO109I RGGNCCY 1 cut(s) 106
EcoRI GAATTC 1 cut(s) 47
EcoRII CCWGG 2 cut(s) 247, 258
FaeI CATG 2 cut(s) 225, 396
FaiI YATR 5 cut(s) 223, 280, 340, 345, 394
FatI CATG 2 cut(s) 221, 392
FblI GTMKAC 1 cut(s) 81
FokI GGATG 2 cut(s) 26, 275
FspBI CTAG 1 cut(s) 356
Hin1I GRCGYC 1 cut(s) 78
Hin1II CATG 2 cut(s) 225, 396
HincII GTYRAC 3 cut(s) 82, 121, 168
HindII GTYRAC 3 cut(s) 82, 121, 168
HpaI GTTAAC 1 cut(s) 121
Hpy166II GTNNAC 4 cut(s) 82, 94, 121, 168
Hpy188I TCNGA 2 cut(s) 31, 237
Hpy188III TCNNGA 1 cut(s) 313
Hpy8I GTNNAC 4 cut(s) 82, 94, 121, 168
Hpy99I CGWCG 3 cut(s) 22, 83, 128
HpyAV CCTTC 2 cut(s) 97, 310
HpyCH4III ACNGT 2 cut(s) 55, 165
HpyCH4IV ACGT 2 cut(s) 78, 123
HpyCH4V TGCA 1 cut(s) 225
HpyF3I CTNAG 2 cut(s) 86, 171
HpySE526I ACGT 2 cut(s) 78, 123
Hsp92I GRCGYC 1 cut(s) 78
Hsp92II CATG 2 cut(s) 225, 396
KspAI GTTAAC 1 cut(s) 121
LmnI GCTCC 1 cut(s) 244
LpnPI CCDG 7 cut(s) 227, 234, 242, 245, 261, 272, 369
LweI GCATC 1 cut(s) 253
MaeI CTAG 1 cut(s) 356
MaeII ACGT 2 cut(s) 78, 123
MboII GAAGA 1 cut(s) 301
MluCI AATT 3 cut(s) 47, 154, 272
MnlI CCTC 5 cut(s) 35, 95, 119, 122, 199
MseI TTAA 1 cut(s) 120
MslI CAYNNNNRTG 2 cut(s) 220, 397
MspR9I CCNGG 2 cut(s) 249, 260
MvaI CCWGG 2 cut(s) 249, 260
NlaIII CATG 2 cut(s) 225, 396
NlaIV GGNNCC 1 cut(s) 246
PcsI WCGNNNNNNNCGW 2 cut(s) 87, 120
PpuMI RGGWCCY 1 cut(s) 106
Psp5II RGGWCCY 1 cut(s) 106
Psp6I CCWGG 2 cut(s) 247, 258
PspGI CCWGG 2 cut(s) 247, 258
PspN4I GGNNCC 1 cut(s) 246
PspPI GGNCC 1 cut(s) 106
PspPPI RGGWCCY 1 cut(s) 106
PstNI CAGNNNCTG 1 cut(s) 235
RsaI GTAC 2 cut(s) 283, 290
RsaNI GTAC 2 cut(s) 282, 289
RseI CAYNNNNRTG 2 cut(s) 220, 397
SalI GTCGAC 1 cut(s) 80
SaqAI TTAA 1 cut(s) 120
Sau96I GGNCC 1 cut(s) 106
ScrFI CCNGG 2 cut(s) 249, 260
SfaNI GCATC 1 cut(s) 253
SinI GGWCC 1 cut(s) 106
SmiMI CAYNNNNRTG 2 cut(s) 220, 397
Sse9I AATT 3 cut(s) 47, 154, 272
SspMI CTAG 1 cut(s) 356
StyD4I CCNGG 2 cut(s) 247, 258
TaaI ACNGT 2 cut(s) 55, 165
TaiI ACGT 2 cut(s) 81, 126
TaqI TCGA 1 cut(s) 81
TasI AATT 3 cut(s) 47, 154, 272
TatI WGTACW 1 cut(s) 281
Tru1I TTAA 1 cut(s) 120
Tru9I TTAA 1 cut(s) 120
TspDTI ATGAA 1 cut(s) 381
VpaK11BI GGWCC 1 cut(s) 106
XapI RAATTY 2 cut(s) 47, 272
XmiI GTMKAC 1 cut(s) 81
XspI CTAG 1 cut(s) 356
ZraI GACGTC 1 cut(s) 79
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.