Rh6BG339100

HUA2-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
OG0013809
Physical Location & Seq
Reverse (-)
57149022 .. 57151175
2154 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG339100.1

Sequence Viewer

Length: 327 bp
ATGGACTGTTTTGAAATCTTGGCATTTCCATGCAACCAGTTTCTGAAGCAGGAGCCTGGAACAAGCCTGGATGCGATTGAATTTGCATGTACAAGGTACAAGGCTGAATATCCAATCTTCAAGAAGATACGTGTGAATGGGCCAAACGCAGAACCTGTCTTTAAATTCCTCAAAGCAAGTAAACCTGGATTTATGGGGAGTAGGATAAAGTGGAACTTCACTAAGTTCTTAGTTAACAAGGATGGCAATGTCATCGGACGTTACAGCCCAACAACCTCTCCCTTAAACATTGAGGCTGACATCAAAAAAGCACTAGGAGAAGTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044464
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
CTD_bind GSHPx PWWP

Protein Analysis

108

Amino Acids

12.2

Weight (kDa)

9.22

Isoelectric Point (pI)

41.53

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
GSHPx PF00255 4 - 58 7.7e-17 Glutathione peroxidase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013809)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G48150 AT2G48150 AT3G63080
fragaria_vesca FvH4_2g23900
malus_domestica MD03G1268500.v1.1 MD11G1289300.v1.1
prunus_persica Prupe.8G244300_v2.0.a1
pyrus_communis pycom11g25670
rosa_chinensis RchiOBHm_Chr6g0291511
rosa_laevigata RLG00000012110
rosa_multiflora Rmu_sc0026626.1_g000001
rosa_roxburghii Rroxscaffold_7G00176010
rosa_rugosa Rorug06G0220100
rosa_samantha Rh6AG332200 Rh6BG339100 Rh6CG345300 Rh6DG332700

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 80, 164
AcuI CTGAAG 1 cut(s) 65
AfaI GTAC 2 cut(s) 91, 98
AflIII ACRYGT 1 cut(s) 130
AgsI TTSAA 3 cut(s) 14, 80, 121
AjnI CCWGG 3 cut(s) 55, 66, 184
AlwNI CAGNNNCTG 2 cut(s) 43, 155
AoxI GGCC 1 cut(s) 140
ApoI RAATTY 2 cut(s) 80, 164
AspS9I GGNCC 1 cut(s) 140
BccI CCATC 1 cut(s) 236
BcgI CGANNNNNNTGC 2 cut(s) 235, 269
BciT130I CCWGG 3 cut(s) 57, 68, 186
BfaI CTAG 1 cut(s) 314
Bme1390I CCNGG 3 cut(s) 57, 68, 186
BmgT120I GGNCC 1 cut(s) 140
BmiI GGNNCC 1 cut(s) 54
BmrFI CCNGG 3 cut(s) 57, 68, 186
BmsI GCATC 1 cut(s) 61
BsaAI YACGTR 1 cut(s) 131
BsaXI ACNNNNNCTCC 2 cut(s) 262, 292
Bse1I ACTGG 1 cut(s) 37
Bse3DI GCAATG 1 cut(s) 253
BseBI CCWGG 3 cut(s) 57, 68, 186
BseGI GGATG 2 cut(s) 76, 247
BseMI GCAATG 1 cut(s) 253
BseNI ACTGG 1 cut(s) 37
BshFI GGCC 1 cut(s) 142
BsnI GGCC 1 cut(s) 142
Bsp1407I TGTACA 1 cut(s) 89
BspANI GGCC 1 cut(s) 142
BspLI GGNNCC 1 cut(s) 54
BsrDI GCAATG 1 cut(s) 253
BsrGI TGTACA 1 cut(s) 89
BsrI ACTGG 1 cut(s) 37
Bst2UI CCWGG 3 cut(s) 57, 68, 186
Bst4CI ACNGT 1 cut(s) 8
BstAUI TGTACA 1 cut(s) 89
BstBAI YACGTR 1 cut(s) 131
BstDEI CTNAG 2 cut(s) 222, 229
BstF5I GGATG 2 cut(s) 76, 247
BstNI CCWGG 3 cut(s) 57, 68, 186
BstNSI RCATGY 1 cut(s) 90
BstSCI CCNGG 3 cut(s) 55, 66, 184
BsuRI GGCC 1 cut(s) 142
BtsCI GGATG 2 cut(s) 76, 247
CaiI CAGNNNCTG 2 cut(s) 43, 155
Cfr13I GGNCC 1 cut(s) 140
Csp6I GTAC 2 cut(s) 90, 97
CviAII CATG 2 cut(s) 30, 87
CviJI RGCY 6 cut(s) 55, 66, 104, 142, 267, 296
CviKI_1 RGCY 6 cut(s) 55, 66, 104, 142, 267, 296
CviQI GTAC 2 cut(s) 90, 97
DdeI CTNAG 2 cut(s) 222, 229
DraI TTTAAA 1 cut(s) 163
Eco57I CTGAAG 1 cut(s) 65
EcoRII CCWGG 3 cut(s) 55, 66, 184
FaeI CATG 2 cut(s) 33, 90
FaiI YATR 4 cut(s) 31, 88, 194, 325
FalI AAGNNNNNCTT 2 cut(s) 200, 232
FatI CATG 2 cut(s) 29, 86
FokI GGATG 2 cut(s) 83, 254
FspBI CTAG 1 cut(s) 314
HaeIII GGCC 1 cut(s) 142
Hin1II CATG 2 cut(s) 33, 90
HincII GTYRAC 1 cut(s) 235
HindII GTYRAC 1 cut(s) 235
HpaI GTTAAC 1 cut(s) 235
Hpy166II GTNNAC 2 cut(s) 182, 235
Hpy188I TCNGA 2 cut(s) 45, 257
Hpy188III TCNNGA 1 cut(s) 121
Hpy8I GTNNAC 2 cut(s) 182, 235
HpyCH4III ACNGT 1 cut(s) 8
HpyCH4IV ACGT 2 cut(s) 130, 259
HpyCH4V TGCA 2 cut(s) 33, 86
HpyF3I CTNAG 2 cut(s) 222, 229
HpySE526I ACGT 2 cut(s) 130, 259
Hsp92II CATG 2 cut(s) 33, 90
KspAI GTTAAC 1 cut(s) 235
LmnI GCTCC 1 cut(s) 52
LpnPI CCDG 9 cut(s) 35, 42, 50, 53, 69, 80, 168, 171, 198
LweI GCATC 1 cut(s) 61
MaeI CTAG 1 cut(s) 314
MaeII ACGT 2 cut(s) 130, 259
MaeIII GTNAC 1 cut(s) 260
MboII GAAGA 2 cut(s) 109, 136
MluCI AATT 2 cut(s) 80, 164
MnlI CCTC 3 cut(s) 179, 286, 286
MseI TTAA 3 cut(s) 162, 234, 284
MslI CAYNNNNRTG 1 cut(s) 28
MspR9I CCNGG 3 cut(s) 57, 68, 186
MvaI CCWGG 3 cut(s) 57, 68, 186
NlaIII CATG 2 cut(s) 33, 90
NlaIV GGNNCC 1 cut(s) 54
NspI RCATGY 1 cut(s) 90
Ppu21I YACGTR 1 cut(s) 131
Psp6I CCWGG 3 cut(s) 55, 66, 184
PspGI CCWGG 3 cut(s) 55, 66, 184
PspN4I GGNNCC 1 cut(s) 54
PspPI GGNCC 1 cut(s) 140
PstNI CAGNNNCTG 2 cut(s) 43, 155
RsaI GTAC 2 cut(s) 91, 98
RsaNI GTAC 2 cut(s) 90, 97
RseI CAYNNNNRTG 1 cut(s) 28
SaqAI TTAA 3 cut(s) 162, 234, 284
Sau96I GGNCC 1 cut(s) 140
ScrFI CCNGG 3 cut(s) 57, 68, 186
SetI ASST 6 cut(s) 98, 133, 157, 187, 262, 278
SfaNI GCATC 1 cut(s) 61
SmiMI CAYNNNNRTG 1 cut(s) 28
Sse9I AATT 2 cut(s) 80, 164
SspMI CTAG 1 cut(s) 314
StyD4I CCNGG 3 cut(s) 55, 66, 184
TaaI ACNGT 1 cut(s) 8
TaiI ACGT 2 cut(s) 133, 262
TasI AATT 2 cut(s) 80, 164
TatI WGTACW 1 cut(s) 89
Tru1I TTAA 3 cut(s) 162, 234, 284
Tru9I TTAA 3 cut(s) 162, 234, 284
XapI RAATTY 2 cut(s) 80, 164
XceI RCATGY 1 cut(s) 90
XspI CTAG 1 cut(s) 314
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.