Rroxscaffold_7G00176010

HUA2-like protein

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
Physical Location & Seq
Forward (+)
15479734 .. 15483673
3940 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00176010.1

Sequence Viewer

Length: 519 bp
ATGGGTGCTACACAGTCCTCGTGCCTCTCCGAAAAATCCATCCACGAATTCACAGTCAAGGATAGCCGAGGCAAGGACGTCGACCTCAGCGTTTACAAAGGGAAGGTCCTCCTCGTGGTTAACGTCGCTTCCAAATGTGGCTTTACCGATACCAATTACACACAGTTGACTGAGCTTTACAGCAAATACAAGGACAAAGGTTTTGAGATCTTGGCATTTCCATGCAACCAGTTTCTGAAGCAGGAGCCTGGAACAAGCCTGGATGCGATTGAATTTGCATGTACAAGGTACAAGGCTGAATATCCAATCTTCAAGAAGATACGTGTGAATGGGCCAAATGCAGAACCTGTCTTTAAATTCCTCAAAGCAAGTAAACCTGGATTTATGGGGAGTAGGATAAAGTGGAACTTCACTAAGTTCTTAGTTAACAAGGATGGCAATGCCATCGGACGTTACAGCCCAACAACCTCTCCCTTAAACATTGAGGCTGACATCAAAAAAGCACTAGGAGAAGTATAA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

172

Amino Acids

19.22

Weight (kDa)

9.27

Isoelectric Point (pI)

33.14

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Redoxin PF08534 12 - 73 2.7e-07 Redoxin
GSHPx PF00255 14 - 122 6.7e-40 Glutathione peroxidase
AhpC-TSA PF00578 14 - 76 1.1e-07 AhpC/TSA family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013809)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 81
AccI GTMKAC 1 cut(s) 81
AcsI RAATTY 3 cut(s) 47, 272, 356
AcuI CTGAAG 1 cut(s) 257
AcyI GRCGYC 1 cut(s) 78
AfaI GTAC 2 cut(s) 283, 290
AfiI CCNNNNNNNGG 2 cut(s) 73, 115
AflIII ACRYGT 1 cut(s) 322
AgsI TTSAA 2 cut(s) 272, 313
AjnI CCWGG 3 cut(s) 247, 258, 376
AluBI AGCT 1 cut(s) 175
AluI AGCT 1 cut(s) 175
AlwNI CAGNNNCTG 2 cut(s) 235, 347
AoxI GGCC 1 cut(s) 332
ApoI RAATTY 3 cut(s) 47, 272, 356
ArsI GACNNNNNNTTYG 6 cut(s) 39, 71, 90, 122, 185, 217
AspS9I GGNCC 2 cut(s) 106, 332
AvaII GGWCC 1 cut(s) 106
BauI CACGAG 2 cut(s) 19, 113
BbvCI CCTCAGC 1 cut(s) 86
BccI CCATC 3 cut(s) 47, 428, 452
BcgI CGANNNNNNTGC 4 cut(s) 61, 95, 427, 461
BciT130I CCWGG 3 cut(s) 249, 260, 378
BfaI CTAG 1 cut(s) 506
BglII AGATCT 1 cut(s) 207
Bme1390I CCNGG 3 cut(s) 249, 260, 378
Bme18I GGWCC 1 cut(s) 106
BmgT120I GGNCC 2 cut(s) 106, 332
BmiI GGNNCC 1 cut(s) 246
BmrFI CCNGG 3 cut(s) 249, 260, 378
BmsI GCATC 1 cut(s) 253
Bpu10I CCTNAGC 1 cut(s) 86
BsaAI YACGTR 1 cut(s) 323
BsaHI GRCGYC 1 cut(s) 78
BsaJI CCNNGG 1 cut(s) 67
BsaXI ACNNNNNCTCC 2 cut(s) 454, 484
Bsc4I CCNNNNNNNGG 2 cut(s) 73, 115
Bse1I ACTGG 1 cut(s) 229
Bse3DI GCAATG 1 cut(s) 445
BseBI CCWGG 3 cut(s) 249, 260, 378
BseDI CCNNGG 1 cut(s) 67
BseGI GGATG 3 cut(s) 39, 268, 439
BseLI CCNNNNNNNGG 2 cut(s) 73, 115
BseMI GCAATG 1 cut(s) 445
BseMII CTCAG 2 cut(s) 100, 162
BseNI ACTGG 1 cut(s) 229
BseRI GAGGAG 1 cut(s) 101
BshFI GGCC 1 cut(s) 334
BslI CCNNNNNNNGG 2 cut(s) 73, 115
BsnI GGCC 1 cut(s) 334
Bsp1407I TGTACA 1 cut(s) 281
Bsp143I GATC 1 cut(s) 207
BspANI GGCC 1 cut(s) 334
BspCNI CTCAG 2 cut(s) 99, 163
BspLI GGNNCC 1 cut(s) 246
BsrDI GCAATG 1 cut(s) 445
BsrGI TGTACA 1 cut(s) 281
BsrI ACTGG 1 cut(s) 229
BssECI CCNNGG 1 cut(s) 67
BssMI GATC 1 cut(s) 207
BssNI GRCGYC 1 cut(s) 78
BssSI CACGAG 2 cut(s) 19, 113
Bst2BI CACGAG 2 cut(s) 19, 113
Bst2UI CCWGG 3 cut(s) 249, 260, 378
Bst4CI ACNGT 3 cut(s) 15, 55, 165
BstACI GRCGYC 1 cut(s) 78
BstAUI TGTACA 1 cut(s) 281
BstBAI YACGTR 1 cut(s) 323
BstDEI CTNAG 4 cut(s) 86, 171, 414, 421
BstF5I GGATG 3 cut(s) 39, 268, 439
BstKTI GATC 1 cut(s) 210
BstMBI GATC 1 cut(s) 207
BstNI CCWGG 3 cut(s) 249, 260, 378
BstNSI RCATGY 1 cut(s) 282
BstSCI CCNGG 3 cut(s) 247, 258, 376
BstX2I RGATCY 1 cut(s) 207
BstYI RGATCY 1 cut(s) 207
BsuRI GGCC 1 cut(s) 334
BtsCI GGATG 3 cut(s) 39, 268, 439
CaiI CAGNNNCTG 2 cut(s) 235, 347
Cfr13I GGNCC 2 cut(s) 106, 332
Csp6I GTAC 2 cut(s) 282, 289
CviAII CATG 2 cut(s) 222, 279
CviJI RGCY 9 cut(s) 66, 141, 175, 247, 258, 296, 334, 459, 488
CviKI_1 RGCY 9 cut(s) 66, 141, 175, 247, 258, 296, 334, 459, 488
CviQI GTAC 2 cut(s) 282, 289
DdeI CTNAG 4 cut(s) 86, 171, 414, 421
DpnI GATC 1 cut(s) 209
DpnII GATC 1 cut(s) 207
DraI TTTAAA 1 cut(s) 355
Eco47I GGWCC 1 cut(s) 106
Eco57I CTGAAG 1 cut(s) 257
EcoO109I RGGNCCY 1 cut(s) 106
EcoRI GAATTC 1 cut(s) 47
EcoRII CCWGG 3 cut(s) 247, 258, 376
FaeI CATG 2 cut(s) 225, 282
FaiI YATR 4 cut(s) 223, 280, 386, 517
FalI AAGNNNNNCTT 2 cut(s) 392, 424
FatI CATG 2 cut(s) 221, 278
FblI GTMKAC 1 cut(s) 81
FokI GGATG 3 cut(s) 26, 275, 446
FspBI CTAG 1 cut(s) 506
HaeIII GGCC 1 cut(s) 334
Hin1I GRCGYC 1 cut(s) 78
Hin1II CATG 2 cut(s) 225, 282
HincII GTYRAC 4 cut(s) 82, 121, 168, 427
HindII GTYRAC 4 cut(s) 82, 121, 168, 427
HpaI GTTAAC 2 cut(s) 121, 427
Hpy166II GTNNAC 6 cut(s) 82, 94, 121, 168, 374, 427
Hpy188I TCNGA 3 cut(s) 31, 237, 449
Hpy188III TCNNGA 1 cut(s) 313
Hpy8I GTNNAC 6 cut(s) 82, 94, 121, 168, 374, 427
Hpy99I CGWCG 2 cut(s) 83, 128
HpyAV CCTTC 1 cut(s) 97
HpyCH4III ACNGT 3 cut(s) 15, 55, 165
HpyCH4IV ACGT 4 cut(s) 78, 123, 322, 451
HpyCH4V TGCA 3 cut(s) 225, 278, 341
HpyF3I CTNAG 4 cut(s) 86, 171, 414, 421
HpySE526I ACGT 4 cut(s) 78, 123, 322, 451
Hsp92I GRCGYC 1 cut(s) 78
Hsp92II CATG 2 cut(s) 225, 282
KspAI GTTAAC 2 cut(s) 121, 427
Kzo9I GATC 1 cut(s) 207
LmnI GCTCC 1 cut(s) 244
LpnPI CCDG 9 cut(s) 227, 234, 242, 245, 261, 272, 360, 363, 390
LweI GCATC 1 cut(s) 253
MaeI CTAG 1 cut(s) 506
MaeII ACGT 4 cut(s) 78, 123, 322, 451
MaeIII GTNAC 1 cut(s) 452
MalI GATC 1 cut(s) 209
MboI GATC 1 cut(s) 207
MboII GAAGA 2 cut(s) 301, 328
MflI RGATCY 1 cut(s) 207
MluCI AATT 4 cut(s) 47, 154, 272, 356
MnlI CCTC 9 cut(s) 28, 35, 62, 95, 119, 122, 371, 478, 478
MseI TTAA 4 cut(s) 120, 354, 426, 476
MslI CAYNNNNRTG 1 cut(s) 220
MspR9I CCNGG 3 cut(s) 249, 260, 378
MvaI CCWGG 3 cut(s) 249, 260, 378
NdeII GATC 1 cut(s) 207
NlaIII CATG 2 cut(s) 225, 282
NlaIV GGNNCC 1 cut(s) 246
NmeAIII GCCGAG 1 cut(s) 92
NspI RCATGY 1 cut(s) 282
PcsI WCGNNNNNNNCGW 2 cut(s) 87, 120
Ppu21I YACGTR 1 cut(s) 323
PpuMI RGGWCCY 1 cut(s) 106
Psp5II RGGWCCY 1 cut(s) 106
Psp6I CCWGG 3 cut(s) 247, 258, 376
PspGI CCWGG 3 cut(s) 247, 258, 376
PspN4I GGNNCC 1 cut(s) 246
PspPI GGNCC 2 cut(s) 106, 332
PspPPI RGGWCCY 1 cut(s) 106
PstNI CAGNNNCTG 2 cut(s) 235, 347
PsuI RGATCY 1 cut(s) 207
RsaI GTAC 2 cut(s) 283, 290
RsaNI GTAC 2 cut(s) 282, 289
RseI CAYNNNNRTG 1 cut(s) 220
SalI GTCGAC 1 cut(s) 80
SaqAI TTAA 4 cut(s) 120, 354, 426, 476
Sau3AI GATC 1 cut(s) 207
Sau96I GGNCC 2 cut(s) 106, 332
ScrFI CCNGG 3 cut(s) 249, 260, 378
SfaNI GCATC 1 cut(s) 253
SinI GGWCC 1 cut(s) 106
SmiMI CAYNNNNRTG 1 cut(s) 220
Sse9I AATT 4 cut(s) 47, 154, 272, 356
SspMI CTAG 1 cut(s) 506
StyD4I CCNGG 3 cut(s) 247, 258, 376
TaaI ACNGT 3 cut(s) 15, 55, 165
TaiI ACGT 4 cut(s) 81, 126, 325, 454
TaqI TCGA 1 cut(s) 81
TasI AATT 4 cut(s) 47, 154, 272, 356
TatI WGTACW 1 cut(s) 281
Tru1I TTAA 4 cut(s) 120, 354, 426, 476
Tru9I TTAA 4 cut(s) 120, 354, 426, 476
VpaK11BI GGWCC 1 cut(s) 106
XapI RAATTY 3 cut(s) 47, 272, 356
XceI RCATGY 1 cut(s) 282
XmiI GTMKAC 1 cut(s) 81
XspI CTAG 1 cut(s) 506
ZraI GACGTC 1 cut(s) 79
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.