FvH4_3g19540

Belongs to the eukaryotic ribosomal protein P1 P2 family

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb3
Physical Location & Seq
Reverse (-)
12645218 .. 12645892
675 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_3g19540.t1

Sequence Viewer

Length: 339 bp
ATGTCGACCGCTGAAGTTGCTTGCTCCTATGCCGCCATGATTCTTCACGACGATGGCATCCCAATCACAGCAGAGAAGATTGCTACCTTGTTGAAATCTGCAAACGTGAAAGTAGATTCCTTGTGGCCAAGCCTCTTTGCCAAGCTTGCTGAGAAGAGGGACGTTATTGGGGACCTTGTTATGAATCCTGTTGGTTCGGCTCAAGCTCCGGTAGCTATGGCTGCTCCTGCTGCTGCTGCAAGTGCTGCTGCTCCGGCTGTTGAGGAGAAGAAGAAGAAGGAAGAAGAACCAGAGGAAGGAAGTGATGATGACATGCCGCTATTCGACTTGTTTAAATGA

Protein Analysis

113

Amino Acids

11.77

Weight (kDa)

4.51

Isoelectric Point (pI)

55.13

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_60s PF00428 22 - 111 1e-21 60s Acidic ribosomal protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 5
AciI CCGC 3 cut(s) 9, 33, 317
AcoI YGGCCR 1 cut(s) 125
AcuI CTGAAG 1 cut(s) 33
AfiI CCNNNNNNNGG 1 cut(s) 296
AgsI TTSAA 1 cut(s) 94
AluBI AGCT 3 cut(s) 145, 206, 215
AluI AGCT 3 cut(s) 145, 206, 215
AoxI GGCC 1 cut(s) 125
ApeKI GCWGC 6 cut(s) 221, 230, 233, 236, 245, 248
AspS9I GGNCC 1 cut(s) 172
AvaII GGWCC 1 cut(s) 172
BalI TGGCCA 1 cut(s) 127
BbvI GCAGC 6 cut(s) 208, 217, 220, 223, 232, 235
BccI CCATC 1 cut(s) 47
BisI GCNGC 8 cut(s) 33, 222, 231, 234, 237, 246, 249, 317
BlsI GCNGC 8 cut(s) 34, 223, 232, 235, 238, 247, 250, 318
Bme18I GGWCC 1 cut(s) 172
BmgT120I GGNCC 1 cut(s) 172
BmiI GGNNCC 1 cut(s) 173
BmsI GCATC 1 cut(s) 66
BpuEI CTTGAG 1 cut(s) 186
BsaWI WCCGGW 1 cut(s) 208
Bsc4I CCNNNNNNNGG 1 cut(s) 296
BseGI GGATG 1 cut(s) 57
BseLI CCNNNNNNNGG 1 cut(s) 296
BseMII CTCAG 1 cut(s) 141
BseRI GAGGAG 1 cut(s) 278
BseXI GCAGC 6 cut(s) 208, 217, 220, 223, 232, 235
Bsh1285I CGRYCG 1 cut(s) 9
BshFI GGCC 1 cut(s) 127
BsiEI CGRYCG 1 cut(s) 9
BsiSI CCGG 2 cut(s) 209, 254
BslFI GGGAC 2 cut(s) 173, 185
BslI CCNNNNNNNGG 1 cut(s) 296
BsmFI GGGAC 2 cut(s) 173, 185
BsnI GGCC 1 cut(s) 127
BspACI CCGC 3 cut(s) 9, 33, 317
BspANI GGCC 1 cut(s) 127
BspCNI CTCAG 1 cut(s) 142
BspLI GGNNCC 1 cut(s) 173
Bst6I CTCTTC 1 cut(s) 149
BstAPI GCANNNNNTGC 1 cut(s) 245
BstC8I GCNNGC 2 cut(s) 22, 147
BstDEI CTNAG 1 cut(s) 150
BstF5I GGATG 1 cut(s) 57
BstMCI CGRYCG 1 cut(s) 9
BstNSI RCATGY 1 cut(s) 316
BstV1I GCAGC 6 cut(s) 208, 217, 220, 223, 232, 235
BsuRI GGCC 1 cut(s) 127
BtsCI GGATG 1 cut(s) 57
Cac8I GCNNGC 2 cut(s) 22, 147
Cfr13I GGNCC 1 cut(s) 172
CviAII CATG 2 cut(s) 37, 313
CviJI RGCY 8 cut(s) 127, 132, 145, 200, 206, 215, 221, 257
CviKI_1 RGCY 8 cut(s) 127, 132, 145, 200, 206, 215, 221, 257
DdeI CTNAG 1 cut(s) 150
DraI TTTAAA 1 cut(s) 334
EaeI YGGCCR 1 cut(s) 125
Eam1104I CTCTTC 1 cut(s) 149
EarI CTCTTC 1 cut(s) 149
Eco47I GGWCC 1 cut(s) 172
Eco57I CTGAAG 1 cut(s) 33
EcoO109I RGGNCCY 1 cut(s) 172
FaeI CATG 2 cut(s) 40, 316
FaiI YATR 5 cut(s) 30, 38, 182, 218, 314
FaqI GGGAC 2 cut(s) 173, 185
FatI CATG 2 cut(s) 36, 312
FblI GTMKAC 1 cut(s) 5
Fnu4HI GCNGC 8 cut(s) 33, 222, 231, 234, 237, 246, 249, 317
FokI GGATG 1 cut(s) 44
Fsp4HI GCNGC 8 cut(s) 33, 222, 231, 234, 237, 246, 249, 317
GluI GCNGC 8 cut(s) 33, 222, 231, 234, 237, 246, 249, 317
HaeIII GGCC 1 cut(s) 127
HapII CCGG 2 cut(s) 209, 254
Hin1II CATG 2 cut(s) 40, 316
HincII GTYRAC 1 cut(s) 6
HindII GTYRAC 1 cut(s) 6
HindIII AAGCTT 1 cut(s) 143
HinfI GANTC 3 cut(s) 40, 116, 184
HpaII CCGG 2 cut(s) 209, 254
Hpy166II GTNNAC 1 cut(s) 6
Hpy188III TCNNGA 1 cut(s) 47
Hpy8I GTNNAC 1 cut(s) 6
Hpy99I CGWCG 1 cut(s) 53
HpyAV CCTTC 2 cut(s) 271, 290
HpyCH4IV ACGT 2 cut(s) 105, 162
HpyCH4V TGCA 2 cut(s) 101, 239
HpyF3I CTNAG 1 cut(s) 150
HpySE526I ACGT 2 cut(s) 105, 162
Hsp92II CATG 2 cut(s) 40, 316
LmnI GCTCC 4 cut(s) 29, 211, 229, 256
LpnPI CCDG 5 cut(s) 201, 222, 240, 267, 303
Lsp1109I GCAGC 6 cut(s) 208, 217, 220, 223, 232, 235
LweI GCATC 1 cut(s) 66
MaeII ACGT 2 cut(s) 105, 162
MboII GAAGA 8 cut(s) 35, 88, 166, 280, 283, 286, 293, 296
MlsI TGGCCA 1 cut(s) 127
MluNI TGGCCA 1 cut(s) 127
MnlI CCTC 4 cut(s) 143, 150, 256, 286
Mox20I TGGCCA 1 cut(s) 127
MscI TGGCCA 1 cut(s) 127
MseI TTAA 1 cut(s) 333
MslI CAYNNNNRTG 1 cut(s) 51
Msp20I TGGCCA 1 cut(s) 127
MspA1I CMGCKG 1 cut(s) 11
MspI CCGG 2 cut(s) 209, 254
NlaIII CATG 2 cut(s) 40, 316
NlaIV GGNNCC 1 cut(s) 173
NspI RCATGY 1 cut(s) 316
PfeI GAWTC 3 cut(s) 40, 116, 184
PkrI GCNGC 8 cut(s) 34, 223, 232, 235, 238, 247, 250, 318
PpuMI RGGWCCY 1 cut(s) 172
Psp5II RGGWCCY 1 cut(s) 172
PspN4I GGNNCC 1 cut(s) 173
PspPI GGNCC 1 cut(s) 172
PspPPI RGGWCCY 1 cut(s) 172
RseI CAYNNNNRTG 1 cut(s) 51
SalI GTCGAC 1 cut(s) 4
SaqAI TTAA 1 cut(s) 333
SatI GCNGC 8 cut(s) 33, 222, 231, 234, 237, 246, 249, 317
Sau96I GGNCC 1 cut(s) 172
SetI ASST 7 cut(s) 89, 108, 147, 165, 177, 208, 217
SfaNI GCATC 1 cut(s) 66
SinI GGWCC 1 cut(s) 172
SmiMI CAYNNNNRTG 1 cut(s) 51
SmlI CTYRAG 1 cut(s) 201
SmoI CTYRAG 1 cut(s) 201
SsiI CCGC 3 cut(s) 9, 33, 317
TaiI ACGT 2 cut(s) 108, 165
TaqI TCGA 2 cut(s) 5, 324
TauI GCSGC 2 cut(s) 35, 319
TfiI GAWTC 3 cut(s) 40, 116, 184
Tru1I TTAA 1 cut(s) 333
Tru9I TTAA 1 cut(s) 333
TseI GCWGC 6 cut(s) 221, 230, 233, 236, 245, 248
TspDTI ATGAA 1 cut(s) 197
VpaK11BI GGWCC 1 cut(s) 172
XceI RCATGY 1 cut(s) 316
XmiI GTMKAC 1 cut(s) 5
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.