FvH4_3g44963

function

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb3
OG0018354
Physical Location & Seq
Forward (+)
37430580 .. 37430974
395 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_3g44963.t1

Sequence Viewer

Length: 309 bp
ATGGACCACTTGGATTTCAACAAGGATCAAGGCAGCAACCATACCAACAAGCTTCACCTCAACAAGCTTCAAGGGCAGTCTATCAAGAACTTGGAGAGACAAGTTGGGCAACTCGCAACGGCGTTGCAAACGAGACCTCAAGGTGTTCTTCCTAGCACAACAGTTCCAAATCCTAAGGATGGGAGCATGGCTGAGCTTAATGCAGTCACTTTGAGAAGTGGAAAACAATTAGAGGAGCCTACTAAGCCTCACAAGTTGTGCTTGACATGGAACCTGAACCTATGCCGTATGATCTTCCTCTCATCCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Asp_protease_2 Retrotrans_gag

Protein Analysis

103

Amino Acids

11.39

Weight (kDa)

9.39

Isoelectric Point (pI)

49.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 33
AfiI CCNNNNNNNGG 1 cut(s) 179
AgsI TTSAA 2 cut(s) 19, 71
AluBI AGCT 3 cut(s) 52, 67, 196
AluI AGCT 3 cut(s) 52, 67, 196
Alw26I GTCTC 2 cut(s) 91, 127
AlwI GGATC 1 cut(s) 33
ApeKI GCWGC 1 cut(s) 33
AspS9I GGNCC 1 cut(s) 4
AsuHPI GGTGA 1 cut(s) 47
AvaII GGWCC 1 cut(s) 4
AxyI CCTNAGG 1 cut(s) 174
BbvI GCAGC 1 cut(s) 45
BccI CCATC 1 cut(s) 173
BceAI ACGGC 2 cut(s) 135, 270
BcoDI GTCTC 2 cut(s) 91, 127
BfaI CTAG 2 cut(s) 153, 307
BisI GCNGC 1 cut(s) 34
BlpI GCTNAGC 1 cut(s) 192
BlsI GCNGC 1 cut(s) 35
Bme18I GGWCC 1 cut(s) 4
BmgT120I GGNCC 1 cut(s) 4
BmiI GGNNCC 2 cut(s) 237, 272
Bpu1102I GCTNAGC 1 cut(s) 192
BpuEI CTTGAG 1 cut(s) 123
BsaI GGTCTC 1 cut(s) 127
Bsc4I CCNNNNNNNGG 1 cut(s) 179
Bse21I CCTNAGG 1 cut(s) 174
BseGI GGATG 2 cut(s) 184, 302
BseLI CCNNNNNNNGG 1 cut(s) 179
BseMII CTCAG 1 cut(s) 183
BseRI GAGGAG 1 cut(s) 248
BseXI GCAGC 1 cut(s) 45
BslI CCNNNNNNNGG 1 cut(s) 179
BsmAI GTCTC 2 cut(s) 91, 127
Bso31I GGTCTC 1 cut(s) 127
Bsp143I GATC 2 cut(s) 25, 291
Bsp1720I GCTNAGC 1 cut(s) 192
BspCNI CTCAG 1 cut(s) 184
BspLI GGNNCC 2 cut(s) 237, 272
BspPI GGATC 1 cut(s) 33
BspTNI GGTCTC 1 cut(s) 127
BssMI GATC 2 cut(s) 25, 291
Bst4CI ACNGT 1 cut(s) 163
BstDEI CTNAG 3 cut(s) 174, 192, 243
BstF5I GGATG 2 cut(s) 184, 302
BstKTI GATC 2 cut(s) 28, 294
BstMAI GTCTC 2 cut(s) 91, 127
BstMBI GATC 2 cut(s) 25, 291
BstMWI GCNNNNNNNGC 2 cut(s) 73, 244
BstV1I GCAGC 1 cut(s) 45
Bsu36I CCTNAGG 1 cut(s) 174
BtsCI GGATG 2 cut(s) 184, 302
Cfr13I GGNCC 1 cut(s) 4
CviAII CATG 2 cut(s) 187, 267
CviJI RGCY 6 cut(s) 52, 67, 191, 196, 238, 247
CviKI_1 RGCY 6 cut(s) 52, 67, 191, 196, 238, 247
DdeI CTNAG 3 cut(s) 174, 192, 243
DpnI GATC 2 cut(s) 27, 293
DpnII GATC 2 cut(s) 25, 291
Eco31I GGTCTC 1 cut(s) 127
Eco47I GGWCC 1 cut(s) 4
Eco81I CCTNAGG 1 cut(s) 174
FaeI CATG 2 cut(s) 190, 270
FaiI YATR 5 cut(s) 42, 188, 268, 283, 290
FalI AAGNNNNNCTT 4 cut(s) 132, 164, 245, 277
FatI CATG 2 cut(s) 186, 266
Fnu4HI GCNGC 1 cut(s) 34
FokI GGATG 2 cut(s) 191, 289
Fsp4HI GCNGC 1 cut(s) 34
FspBI CTAG 2 cut(s) 153, 307
GluI GCNGC 1 cut(s) 34
Hin1II CATG 2 cut(s) 190, 270
HindIII AAGCTT 2 cut(s) 50, 65
HphI GGTGA 1 cut(s) 47
Hpy188III TCNNGA 1 cut(s) 85
HpyCH4III ACNGT 1 cut(s) 163
HpyCH4V TGCA 2 cut(s) 127, 203
HpyF10VI GCNNNNNNNGC 2 cut(s) 73, 244
HpyF3I CTNAG 3 cut(s) 174, 192, 243
Hsp92II CATG 2 cut(s) 190, 270
Kzo9I GATC 2 cut(s) 25, 291
LmnI GCTCC 2 cut(s) 183, 235
LpnPI CCDG 1 cut(s) 287
Lsp1109I GCAGC 1 cut(s) 45
MaeI CTAG 2 cut(s) 153, 307
MaeIII GTNAC 1 cut(s) 205
MalI GATC 2 cut(s) 27, 293
MboI GATC 2 cut(s) 25, 291
MboII GAAGA 2 cut(s) 140, 286
MluCI AATT 1 cut(s) 227
MnlI CCTC 5 cut(s) 68, 147, 226, 258, 308
MseI TTAA 1 cut(s) 198
MwoI GCNNNNNNNGC 2 cut(s) 73, 244
NdeII GATC 2 cut(s) 25, 291
NlaIII CATG 2 cut(s) 190, 270
NlaIV GGNNCC 2 cut(s) 237, 272
NmuCI GTSAC 1 cut(s) 205
PkrI GCNGC 1 cut(s) 35
PspN4I GGNNCC 2 cut(s) 237, 272
PspPI GGNCC 1 cut(s) 4
SaqAI TTAA 1 cut(s) 198
SatI GCNGC 1 cut(s) 34
Sau3AI GATC 2 cut(s) 25, 291
Sau96I GGNCC 1 cut(s) 4
SetI ASST 8 cut(s) 54, 60, 69, 139, 145, 198, 276, 282
SinI GGWCC 1 cut(s) 4
SmlI CTYRAG 1 cut(s) 138
SmoI CTYRAG 1 cut(s) 138
Sse9I AATT 1 cut(s) 227
SspMI CTAG 2 cut(s) 153, 307
TaaI ACNGT 1 cut(s) 163
TasI AATT 1 cut(s) 227
Tru1I TTAA 1 cut(s) 198
Tru9I TTAA 1 cut(s) 198
TseFI GTSAC 1 cut(s) 205
TseI GCWGC 1 cut(s) 33
Tsp45I GTSAC 1 cut(s) 205
VpaK11BI GGWCC 1 cut(s) 4
XspI CTAG 2 cut(s) 153, 307
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.