Basic Information

Type: gene

Biological Identity

Species

fragaria_vesca

Chromosome

Fvb5

Orthogroup ID

OG0018354

Physical Location & Seq

Genomic Coordinates Forward (+)

22839095 .. 22839474

Gene Structure 380 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

FvH4_5g31681.t1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 294 bp

ATGGACCACCTGGATTTCAACAAGGATCAAGGCAGCAACCATACCAACAAGCTTCACCTCAACAAGCTTCAAGGGCAGTCTATCAAGAACTTGGAGAGACAAGTTGGGCAACTTGCAACGGCATTGCAAACAATACCTCAAGGTGTTCTTCCTAGCACAACAGTTCAAAATCCTAAGGATGGGAGCATGGCTGAGCTTAATGCAGTCACTTTGAGAAGTGGAAAACAATTAGAGGAGCCTACTAAGCCTCACAAGATGTCCAAGAGTGGTCAAGCTGAGAAGTATGAGCTGTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Asp_protease_2 Retrotrans_gag

Protein Analysis

98

Amino Acids

10.72

Weight (kDa)

9.01

Isoelectric Point (pI)

51.04

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018354)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g19424 FvH4_3g44963 FvH4_4g09141 FvH4_5g31681 FvH4_5g37422
rosa_chinensis	RchiOBHm_Chr3g0494871
rosa_multiflora	Rmu_sc0003737.1_g000016 Rmu_sc0003798.1_g000004 Rmu_sc0013383.1_g000001 Rmu_sc0019276.1_g000001

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	33
AfiI	CCNNNNNNNGG	1 cut(s)	179
AgsI	TTSAA	3 cut(s)	19, 71, 167
AjnI	CCWGG	1 cut(s)	9
AluBI	AGCT	5 cut(s)	52, 67, 196, 275, 289
AluI	AGCT	5 cut(s)	52, 67, 196, 275, 289
Alw26I	GTCTC	1 cut(s)	91
AlwI	GGATC	1 cut(s)	33
ApeKI	GCWGC	1 cut(s)	33
AspS9I	GGNCC	1 cut(s)	4
AsuHPI	GGTGA	1 cut(s)	47
AvaII	GGWCC	1 cut(s)	4
AxyI	CCTNAGG	1 cut(s)	174
BbvI	GCAGC	1 cut(s)	45
BccI	CCATC	1 cut(s)	173
BceAI	ACGGC	1 cut(s)	135
BciT130I	CCWGG	1 cut(s)	11
BcoDI	GTCTC	1 cut(s)	91
BfaI	CTAG	1 cut(s)	153
BisI	GCNGC	1 cut(s)	34
BlpI	GCTNAGC	1 cut(s)	192
BlsI	GCNGC	1 cut(s)	35
Bme1390I	CCNGG	1 cut(s)	11
Bme18I	GGWCC	1 cut(s)	4
BmgT120I	GGNCC	1 cut(s)	4
BmiI	GGNNCC	1 cut(s)	237
BmrFI	CCNGG	1 cut(s)	11
Bpu1102I	GCTNAGC	1 cut(s)	192
BpuEI	CTTGAG	1 cut(s)	123
Bsc4I	CCNNNNNNNGG	1 cut(s)	179
Bse21I	CCTNAGG	1 cut(s)	174
Bse3DI	GCAATG	1 cut(s)	122
BseBI	CCWGG	1 cut(s)	11
BseGI	GGATG	1 cut(s)	184
BseLI	CCNNNNNNNGG	1 cut(s)	179
BseMI	GCAATG	1 cut(s)	122
BseMII	CTCAG	2 cut(s)	183, 267
BseRI	GAGGAG	1 cut(s)	248
BseXI	GCAGC	1 cut(s)	45
BslI	CCNNNNNNNGG	1 cut(s)	179
BsmAI	GTCTC	1 cut(s)	91
Bsp143I	GATC	1 cut(s)	25
Bsp1720I	GCTNAGC	1 cut(s)	192
BspCNI	CTCAG	2 cut(s)	184, 268
BspLI	GGNNCC	1 cut(s)	237
BspPI	GGATC	1 cut(s)	33
BsrDI	GCAATG	1 cut(s)	122
BssMI	GATC	1 cut(s)	25
Bst2UI	CCWGG	1 cut(s)	11
Bst4CI	ACNGT	1 cut(s)	163
BstDEI	CTNAG	4 cut(s)	174, 192, 243, 276
BstF5I	GGATG	1 cut(s)	184
BstKTI	GATC	1 cut(s)	28
BstMAI	GTCTC	1 cut(s)	91
BstMBI	GATC	1 cut(s)	25
BstMWI	GCNNNNNNNGC	2 cut(s)	73, 244
BstNI	CCWGG	1 cut(s)	11
BstSCI	CCNGG	1 cut(s)	9
BstV1I	GCAGC	1 cut(s)	45
Bsu36I	CCTNAGG	1 cut(s)	174
BtsCI	GGATG	1 cut(s)	184
Cfr13I	GGNCC	1 cut(s)	4
CviAII	CATG	1 cut(s)	187
CviJI	RGCY	8 cut(s)	52, 67, 191, 196, 238, 247, 275, 289
CviKI_1	RGCY	8 cut(s)	52, 67, 191, 196, 238, 247, 275, 289
DdeI	CTNAG	4 cut(s)	174, 192, 243, 276
DpnI	GATC	1 cut(s)	27
DpnII	GATC	1 cut(s)	25
Eco47I	GGWCC	1 cut(s)	4
Eco81I	CCTNAGG	1 cut(s)	174
EcoRII	CCWGG	1 cut(s)	9
FaeI	CATG	1 cut(s)	190
FaiI	YATR	3 cut(s)	42, 188, 285
FalI	AAGNNNNNCTT	2 cut(s)	132, 164
FatI	CATG	1 cut(s)	186
Fnu4HI	GCNGC	1 cut(s)	34
FokI	GGATG	1 cut(s)	191
Fsp4HI	GCNGC	1 cut(s)	34
FspBI	CTAG	1 cut(s)	153
GluI	GCNGC	1 cut(s)	34
Hin1II	CATG	1 cut(s)	190
HindIII	AAGCTT	2 cut(s)	50, 65
HphI	GGTGA	1 cut(s)	47
Hpy188III	TCNNGA	1 cut(s)	85
HpyCH4III	ACNGT	1 cut(s)	163
HpyCH4V	TGCA	3 cut(s)	116, 127, 203
HpyF10VI	GCNNNNNNNGC	2 cut(s)	73, 244
HpyF3I	CTNAG	4 cut(s)	174, 192, 243, 276
Hsp92II	CATG	1 cut(s)	190
Kzo9I	GATC	1 cut(s)	25
LmnI	GCTCC	2 cut(s)	183, 235
LpnPI	CCDG	1 cut(s)	23
Lsp1109I	GCAGC	1 cut(s)	45
MaeI	CTAG	1 cut(s)	153
MaeIII	GTNAC	1 cut(s)	205
MalI	GATC	1 cut(s)	27
MboI	GATC	1 cut(s)	25
MboII	GAAGA	1 cut(s)	140
MluCI	AATT	1 cut(s)	227
MnlI	CCTC	4 cut(s)	68, 147, 226, 258
MseI	TTAA	1 cut(s)	198
MspR9I	CCNGG	1 cut(s)	11
MvaI	CCWGG	1 cut(s)	11
MwoI	GCNNNNNNNGC	2 cut(s)	73, 244
NdeII	GATC	1 cut(s)	25
NlaIII	CATG	1 cut(s)	190
NlaIV	GGNNCC	1 cut(s)	237
NmuCI	GTSAC	1 cut(s)	205
PkrI	GCNGC	1 cut(s)	35
Psp6I	CCWGG	1 cut(s)	9
PspGI	CCWGG	1 cut(s)	9
PspN4I	GGNNCC	1 cut(s)	237
PspPI	GGNCC	1 cut(s)	4
SaqAI	TTAA	1 cut(s)	198
SatI	GCNGC	1 cut(s)	34
Sau3AI	GATC	1 cut(s)	25
Sau96I	GGNCC	1 cut(s)	4
ScrFI	CCNGG	1 cut(s)	11
SetI	ASST	9 cut(s)	12, 54, 60, 69, 139, 145, 198, 277, 291
SinI	GGWCC	1 cut(s)	4
SmlI	CTYRAG	1 cut(s)	138
SmoI	CTYRAG	1 cut(s)	138
Sse9I	AATT	1 cut(s)	227
SspMI	CTAG	1 cut(s)	153
StyD4I	CCNGG	1 cut(s)	9
TaaI	ACNGT	1 cut(s)	163
TasI	AATT	1 cut(s)	227
Tru1I	TTAA	1 cut(s)	198
Tru9I	TTAA	1 cut(s)	198
TseFI	GTSAC	1 cut(s)	205
TseI	GCWGC	1 cut(s)	33
Tsp45I	GTSAC	1 cut(s)	205
VpaK11BI	GGWCC	1 cut(s)	4
XspI	CTAG	1 cut(s)	153

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.