Rmu_sc0019276.1_g000001

transposition, RNA-mediated

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0019276.1
OG0018354
Physical Location & Seq
Reverse (-)
2 .. 394
393 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0019276.1_g000001.1.cds

Sequence Viewer

Length: 393 bp
atgtctgtggaagatatgattaaaaatctgactattactgctaccaacttggtgcagacgacagctacatatcaacaaaagacggatagatctattgagaatcttgagcgtcaagtgacacaaattgcaaacatggcgggccaacaacctcaaaccggcaaacttccgagccaaacggttgtgaaccccaaaggggggtttgagaatgcaagtgctatcactctacgaagtggaaaagaagtcctagaggctccaagggagaacaacagggttaggaaggctgttgatgtagaggaagaacaagaagaagtctcggccaccaaaaacgatcgatcacaggaaccaaacgatcgatcgtttggtgttccagaaagtcacagaagcaaaacaatc
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Asp_protease_2 RVT_1 Retrotrans_gag rve

Protein Analysis

131

Amino Acids

14.57

Weight (kDa)

5.51

Isoelectric Point (pI)

60.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 137
AcoI YGGCCR 1 cut(s) 315
AfiI CCNNNNNNNGG 4 cut(s) 155, 193, 194, 195
AluBI AGCT 1 cut(s) 65
AluI AGCT 1 cut(s) 65
Alw26I GTCTC 1 cut(s) 316
AoxI GGCC 2 cut(s) 139, 315
AspS9I GGNCC 1 cut(s) 139
BcoDI GTCTC 1 cut(s) 316
BfaI CTAG 1 cut(s) 245
BglII AGATCT 1 cut(s) 89
BmgT120I GGNCC 1 cut(s) 139
BmiI GGNNCC 2 cut(s) 252, 342
BpuEI CTTGAG 1 cut(s) 125
Bsa29I ATCGAT 2 cut(s) 331, 352
BsaJI CCNNGG 1 cut(s) 254
Bsc4I CCNNNNNNNGG 4 cut(s) 155, 193, 194, 195
Bse118I RCCGGY 1 cut(s) 155
BseCI ATCGAT 2 cut(s) 331, 352
BseDI CCNNGG 1 cut(s) 254
BseLI CCNNNNNNNGG 4 cut(s) 155, 193, 194, 195
BsgI GTGCAG 1 cut(s) 74
Bsh1285I CGRYCG 3 cut(s) 331, 352, 356
BshFI GGCC 2 cut(s) 141, 317
BshVI ATCGAT 2 cut(s) 331, 352
BsiEI CGRYCG 3 cut(s) 331, 352, 356
BsiSI CCGG 1 cut(s) 156
BslI CCNNNNNNNGG 4 cut(s) 155, 193, 194, 195
BsmAI GTCTC 1 cut(s) 316
BsmI GAATGC 1 cut(s) 211
BsnI GGCC 2 cut(s) 141, 317
Bsp143I GATC 5 cut(s) 89, 328, 332, 349, 353
BspACI CCGC 1 cut(s) 137
BspANI GGCC 2 cut(s) 141, 317
BspDI ATCGAT 2 cut(s) 331, 352
BspLI GGNNCC 2 cut(s) 252, 342
BsrFI RCCGGY 1 cut(s) 155
BssAI RCCGGY 1 cut(s) 155
BssECI CCNNGG 1 cut(s) 254
BssMI GATC 5 cut(s) 89, 328, 332, 349, 353
BssT1I CCWWGG 1 cut(s) 254
Bst4CI ACNGT 1 cut(s) 178
BstC8I GCNNGC 1 cut(s) 139
BstKTI GATC 5 cut(s) 92, 331, 335, 352, 356
BstMAI GTCTC 1 cut(s) 316
BstMBI GATC 5 cut(s) 89, 328, 332, 349, 353
BstMCI CGRYCG 3 cut(s) 331, 352, 356
BstMWI GCNNNNNNNGC 1 cut(s) 134
BstX2I RGATCY 1 cut(s) 89
BstYI RGATCY 1 cut(s) 89
Bsu15I ATCGAT 2 cut(s) 331, 352
BsuRI GGCC 2 cut(s) 141, 317
BsuTUI ATCGAT 2 cut(s) 331, 352
Cac8I GCNNGC 1 cut(s) 139
Cfr10I RCCGGY 1 cut(s) 155
Cfr13I GGNCC 1 cut(s) 139
ClaI ATCGAT 2 cut(s) 331, 352
CseI GACGC 1 cut(s) 98
CviAII CATG 1 cut(s) 133
CviJI RGCY 6 cut(s) 65, 141, 171, 251, 281, 317
CviKI_1 RGCY 6 cut(s) 65, 141, 171, 251, 281, 317
DpnI GATC 5 cut(s) 91, 330, 334, 351, 355
DpnII GATC 5 cut(s) 89, 328, 332, 349, 353
EaeI YGGCCR 1 cut(s) 315
Eco130I CCWWGG 1 cut(s) 254
EcoT14I CCWWGG 1 cut(s) 254
ErhI CCWWGG 1 cut(s) 254
FaeI CATG 1 cut(s) 136
FaiI YATR 3 cut(s) 17, 70, 134
FatI CATG 1 cut(s) 132
FauI CCCGC 1 cut(s) 130
FspBI CTAG 1 cut(s) 245
HaeIII GGCC 2 cut(s) 141, 317
HapII CCGG 1 cut(s) 156
HgaI GACGC 1 cut(s) 98
Hin1II CATG 1 cut(s) 136
HinfI GANTC 1 cut(s) 100
HpaII CCGG 1 cut(s) 156
Hpy166II GTNNAC 1 cut(s) 184
Hpy188I TCNGA 2 cut(s) 30, 168
Hpy188III TCNNGA 2 cut(s) 104, 368
Hpy8I GTNNAC 1 cut(s) 184
HpyAV CCTTC 1 cut(s) 271
HpyCH4III ACNGT 1 cut(s) 178
HpyCH4V TGCA 3 cut(s) 55, 128, 209
HpyF10VI GCNNNNNNNGC 1 cut(s) 134
Hsp92II CATG 1 cut(s) 136
Kzo9I GATC 5 cut(s) 89, 328, 332, 349, 353
LmnI GCTCC 1 cut(s) 256
LpnPI CCDG 4 cut(s) 169, 253, 323, 381
MaeI CTAG 1 cut(s) 245
MaeIII GTNAC 2 cut(s) 115, 374
MalI GATC 5 cut(s) 91, 330, 334, 351, 355
MboI GATC 5 cut(s) 89, 328, 332, 349, 353
MboII GAAGA 3 cut(s) 23, 308, 317
MflI RGATCY 1 cut(s) 89
MluCI AATT 1 cut(s) 123
MnlI CCTC 3 cut(s) 159, 241, 286
MseI TTAA 1 cut(s) 21
MspI CCGG 1 cut(s) 156
Mva1269I GAATGC 1 cut(s) 211
MwoI GCNNNNNNNGC 1 cut(s) 134
NdeII GATC 5 cut(s) 89, 328, 332, 349, 353
NlaIII CATG 1 cut(s) 136
NlaIV GGNNCC 2 cut(s) 252, 342
NmeAIII GCCGAG 1 cut(s) 293
NmuCI GTSAC 2 cut(s) 115, 374
PctI GAATGC 1 cut(s) 211
PfeI GAWTC 1 cut(s) 100
Ple19I CGATCG 3 cut(s) 331, 352, 356
PspN4I GGNNCC 2 cut(s) 252, 342
PspPI GGNCC 1 cut(s) 139
PsuI RGATCY 1 cut(s) 89
PvuI CGATCG 3 cut(s) 331, 352, 356
SaqAI TTAA 1 cut(s) 21
Sau3AI GATC 5 cut(s) 89, 328, 332, 349, 353
Sau96I GGNCC 1 cut(s) 139
SetI ASST 2 cut(s) 67, 151
SmlI CTYRAG 1 cut(s) 104
SmoI CTYRAG 1 cut(s) 104
Sse9I AATT 1 cut(s) 123
SsiI CCGC 1 cut(s) 137
SspMI CTAG 1 cut(s) 245
StyI CCWWGG 1 cut(s) 254
TaaI ACNGT 1 cut(s) 178
TaqI TCGA 2 cut(s) 331, 352
TasI AATT 1 cut(s) 123
TfiI GAWTC 1 cut(s) 100
Tru1I TTAA 1 cut(s) 21
Tru9I TTAA 1 cut(s) 21
TseFI GTSAC 2 cut(s) 115, 374
Tsp45I GTSAC 2 cut(s) 115, 374
TspGWI ACGGA 1 cut(s) 98
XspI CTAG 1 cut(s) 245
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.