FvH4_4g07380

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb4
OG0010331
Physical Location & Seq
Forward (+)
6754139 .. 6758033
3895 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_4g07380.t1

Sequence Viewer

Length: 486 bp
ATGAGGGAGTCGTCATCATTCTTTGATACAATGATGAGTCATCTACGTTCAACATCCAAGTATTATACTGGTTACCCAAAGGATCTTGGGCCATCAAGGGTTATCCATTTTACATCAGAGCGTGAATTTGTCCAGCTCCTACATGAAGGTTATCCTGTGGTTGTGGCATTCACCATCAGGTGTAATCTTACAAAACATCTTGACAAAGTATTAGAGGAAGCTGCTGCTGAGTTCTATCCACATGTGAAATTTATGCGTGTTGAGTGCCCAAAATATCCTGGTTTCTGTATTACACGGCAGAAGAAGGAATATCCATTTATAGAAGTATTTCATAGTCCAGAACAAGCATCTAGCCAGGGAAAGGTTGCTGATCCAAATATTACTAAGTATTCAGTGAAGGTTCTACCTTACCATAACGACACTAGTGCCTATGGATTTAGAGAATTCTTCAGGCGCAACGGAATACGGTCATCAAATCCACAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

162

Amino Acids

18.78

Weight (kDa)

9.1

Isoelectric Point (pI)

55.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 90, 365
AcsI RAATTY 3 cut(s) 125, 248, 443
AcuI CTGAAG 1 cut(s) 433
AfiI CCNNNNNNNGG 1 cut(s) 361
AflIII ACRYGT 1 cut(s) 241
AgsI TTSAA 1 cut(s) 51
AhlI ACTAGT 1 cut(s) 422
AjnI CCWGG 2 cut(s) 277, 354
AluBI AGCT 2 cut(s) 136, 221
AluI AGCT 2 cut(s) 136, 221
AlwI GGATC 2 cut(s) 90, 365
AoxI GGCC 1 cut(s) 89
ApeKI GCWGC 2 cut(s) 221, 224
ApoI RAATTY 3 cut(s) 125, 248, 443
Asp700I GAANNNNTTC 1 cut(s) 327
AspLEI GCGC 1 cut(s) 456
AspS9I GGNCC 1 cut(s) 89
AsuHPI GGTGA 1 cut(s) 163
BaeGI GKGCMC 1 cut(s) 269
BbvI GCAGC 2 cut(s) 208, 211
BccI CCATC 2 cut(s) 100, 182
BceAI ACGGC 1 cut(s) 311
BcgI CGANNNNNNTGC 2 cut(s) 407, 441
BciT130I CCWGG 2 cut(s) 279, 356
BcuI ACTAGT 1 cut(s) 422
BfaI CTAG 2 cut(s) 351, 423
BisI GCNGC 2 cut(s) 222, 225
BlsI GCNGC 2 cut(s) 223, 226
Bme1390I CCNGG 2 cut(s) 279, 356
BmgT120I GGNCC 1 cut(s) 89
BmrFI CCNGG 2 cut(s) 279, 356
BmsI GCATC 1 cut(s) 356
BsaJI CCNNGG 1 cut(s) 355
Bsc4I CCNNNNNNNGG 1 cut(s) 361
Bse1I ACTGG 1 cut(s) 73
BseBI CCWGG 2 cut(s) 279, 356
BseDI CCNNGG 1 cut(s) 355
BseGI GGATG 1 cut(s) 53
BseLI CCNNNNNNNGG 1 cut(s) 361
BseMII CTCAG 1 cut(s) 219
BseNI ACTGG 1 cut(s) 73
BseSI GKGCMC 1 cut(s) 269
BseXI GCAGC 2 cut(s) 208, 211
BshFI GGCC 1 cut(s) 91
BslI CCNNNNNNNGG 1 cut(s) 361
BsmI GAATGC 1 cut(s) 167
BsnI GGCC 1 cut(s) 91
Bsp1286I GDGCHC 1 cut(s) 269
Bsp143I GATC 2 cut(s) 82, 370
BspANI GGCC 1 cut(s) 91
BspCNI CTCAG 1 cut(s) 220
BspPI GGATC 2 cut(s) 90, 365
BsrI ACTGG 1 cut(s) 73
BssECI CCNNGG 1 cut(s) 355
BssMI GATC 2 cut(s) 82, 370
Bst2UI CCWGG 2 cut(s) 279, 356
Bst4CI ACNGT 2 cut(s) 468, 483
BstDEI CTNAG 2 cut(s) 228, 384
BstEII GGTNACC 1 cut(s) 71
BstF5I GGATG 1 cut(s) 53
BstHHI GCGC 1 cut(s) 456
BstKTI GATC 2 cut(s) 85, 373
BstMBI GATC 2 cut(s) 82, 370
BstNI CCWGG 2 cut(s) 279, 356
BstNSI RCATGY 1 cut(s) 245
BstPI GGTNACC 1 cut(s) 71
BstSCI CCNGG 2 cut(s) 277, 354
BstSLI GKGCMC 1 cut(s) 269
BstV1I GCAGC 2 cut(s) 208, 211
BstX2I RGATCY 1 cut(s) 82
BstYI RGATCY 1 cut(s) 82
BsuRI GGCC 1 cut(s) 91
BtsCI GGATG 1 cut(s) 53
BtsIMutI CAGTG 1 cut(s) 399
CfoI GCGC 1 cut(s) 456
Cfr13I GGNCC 1 cut(s) 89
CviAII CATG 2 cut(s) 143, 242
CviJI RGCY 4 cut(s) 91, 136, 221, 354
CviKI_1 RGCY 4 cut(s) 91, 136, 221, 354
DdeI CTNAG 2 cut(s) 228, 384
DpnI GATC 2 cut(s) 84, 372
DpnII GATC 2 cut(s) 82, 370
Eco57I CTGAAG 1 cut(s) 433
Eco91I GGTNACC 1 cut(s) 71
EcoO65I GGTNACC 1 cut(s) 71
EcoRI GAATTC 1 cut(s) 443
EcoRII CCWGG 2 cut(s) 277, 354
FaeI CATG 2 cut(s) 146, 245
FaiI YATR 8 cut(s) 66, 144, 243, 254, 320, 333, 414, 432
FatI CATG 2 cut(s) 142, 241
Fnu4HI GCNGC 2 cut(s) 222, 225
FokI GGATG 1 cut(s) 40
Fsp4HI GCNGC 2 cut(s) 222, 225
FspBI CTAG 2 cut(s) 351, 423
GlaI GCGC 1 cut(s) 455
GluI GCNGC 2 cut(s) 222, 225
HaeIII GGCC 1 cut(s) 91
HhaI GCGC 1 cut(s) 456
Hin1II CATG 2 cut(s) 146, 245
Hin6I GCGC 1 cut(s) 454
HinP1I GCGC 1 cut(s) 454
HinfI GANTC 2 cut(s) 8, 37
HphI GGTGA 1 cut(s) 163
Hpy188I TCNGA 1 cut(s) 118
Hpy188III TCNNGA 2 cut(s) 200, 338
HpyAV CCTTC 3 cut(s) 140, 298, 391
HpyCH4III ACNGT 2 cut(s) 468, 483
HpyCH4IV ACGT 1 cut(s) 46
HpyF3I CTNAG 2 cut(s) 228, 384
HpySE526I ACGT 1 cut(s) 46
Hsp92II CATG 2 cut(s) 146, 245
HspAI GCGC 1 cut(s) 454
Kzo9I GATC 2 cut(s) 82, 370
LmnI GCTCC 1 cut(s) 141
Lsp1109I GCAGC 2 cut(s) 208, 211
LweI GCATC 1 cut(s) 356
MaeI CTAG 2 cut(s) 351, 423
MaeII ACGT 1 cut(s) 46
MaeIII GTNAC 1 cut(s) 71
MalI GATC 2 cut(s) 84, 372
MboI GATC 2 cut(s) 82, 370
MboII GAAGA 2 cut(s) 313, 439
MflI RGATCY 1 cut(s) 82
MhlI GDGCHC 1 cut(s) 269
MluCI AATT 3 cut(s) 125, 248, 443
MlyI GAGTC 2 cut(s) 17, 46
MnlI CCTC 1 cut(s) 208
MroXI GAANNNNTTC 1 cut(s) 327
MspR9I CCNGG 2 cut(s) 279, 356
Mva1269I GAATGC 1 cut(s) 167
MvaI CCWGG 2 cut(s) 279, 356
NdeII GATC 2 cut(s) 82, 370
NlaIII CATG 2 cut(s) 146, 245
NspI RCATGY 1 cut(s) 245
PciI ACATGT 1 cut(s) 241
PctI GAATGC 1 cut(s) 167
PdmI GAANNNNTTC 1 cut(s) 327
PkrI GCNGC 2 cut(s) 223, 226
PleI GAGTC 2 cut(s) 16, 45
PpsI GAGTC 2 cut(s) 16, 45
PscI ACATGT 1 cut(s) 241
Psp6I CCWGG 2 cut(s) 277, 354
PspEI GGTNACC 1 cut(s) 71
PspGI CCWGG 2 cut(s) 277, 354
PspPI GGNCC 1 cut(s) 89
PsuI RGATCY 1 cut(s) 82
SatI GCNGC 2 cut(s) 222, 225
Sau3AI GATC 2 cut(s) 82, 370
Sau96I GGNCC 1 cut(s) 89
SchI GAGTC 2 cut(s) 17, 46
ScrFI CCNGG 2 cut(s) 279, 356
SduI GDGCHC 1 cut(s) 269
SetI ASST 8 cut(s) 49, 138, 151, 182, 223, 366, 402, 409
SfaNI GCATC 1 cut(s) 356
SpeI ACTAGT 1 cut(s) 422
Sse9I AATT 3 cut(s) 125, 248, 443
SspI AATATT 1 cut(s) 379
SspMI CTAG 2 cut(s) 351, 423
StyD4I CCNGG 2 cut(s) 277, 354
TaaI ACNGT 2 cut(s) 468, 483
TaiI ACGT 1 cut(s) 49
TasI AATT 3 cut(s) 125, 248, 443
TscAI CASTG 1 cut(s) 399
TseI GCWGC 2 cut(s) 221, 224
TspDTI ATGAA 2 cut(s) 159, 320
TspGWI ACGGA 1 cut(s) 474
TspRI CASTG 1 cut(s) 399
XapI RAATTY 3 cut(s) 125, 248, 443
XceI RCATGY 1 cut(s) 245
XmnI GAANNNNTTC 1 cut(s) 327
XspI CTAG 2 cut(s) 351, 423
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.