Prupe.1G076700_v2.0.a1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
OG0010331
Physical Location & Seq
Forward (+)
5548713 .. 5551827
3115 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G076700.1

Sequence Viewer

Length: 483 bp
ATGGGGGAGCCATCACTTTTTGATAAAATGATCAACCATCTCCGTGCAACTTCCAAGTATTATACTGGTTATCCAAAGGATCTTGGGCCATCAAGGATCATCCATTTTACATCAGAACGTGAGTTTGTGCAGCTCCTTCACGAAGGCTATCCCGTGGTTGTTGCATTCACCCTCAGGTGTAATCTCACAAGGCATCTTGATAGCGTATTGGAGGAAGCTGCAGCCGAGTTTCATCCGCATGTAAAATTTATGCGTGTTGAATGCCCAAAATATCCTGGATTCTGTATTACGCGGCAGAGGAAGGAATATCCATTTATAGAAATATTTCATAGTCCCCAACAAACACTTAACCAGGGAAGGGTTGCTGATCCAAATATTACAAAGTATGCTGTGAAAGTTCTACCTTTCAATTACGACACTAGTGCCTATGGATTTAGAGAATTTTTCAAGCGCCATGGAATACAGGTTTCAAATCCACAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

161

Amino Acids

18.69

Weight (kDa)

8.97

Isoelectric Point (pI)

48.91

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 292
AciI CCGC 2 cut(s) 236, 292
AclWI GGATC 3 cut(s) 87, 104, 362
AcsI RAATTY 2 cut(s) 245, 440
AfiI CCNNNNNNNGG 1 cut(s) 358
AgsI TTSAA 4 cut(s) 260, 409, 448, 471
AhlI ACTAGT 1 cut(s) 419
AjnI CCWGG 2 cut(s) 274, 351
AluBI AGCT 2 cut(s) 133, 218
AluI AGCT 2 cut(s) 133, 218
AlwI GGATC 3 cut(s) 87, 104, 362
AoxI GGCC 1 cut(s) 86
ApeKI GCWGC 3 cut(s) 130, 218, 221
ApoI RAATTY 2 cut(s) 245, 440
Asp700I GAANNNNTTC 1 cut(s) 324
AspLEI GCGC 1 cut(s) 453
AspS9I GGNCC 1 cut(s) 86
AsuHPI GGTGA 1 cut(s) 160
AxyI CCTNAGG 1 cut(s) 173
BbvI GCAGC 3 cut(s) 142, 205, 233
BccI CCATC 3 cut(s) 19, 45, 97
BcgI CGANNNNNNTGC 2 cut(s) 404, 438
BciT130I CCWGG 2 cut(s) 276, 353
BclI TGATCA 1 cut(s) 30
BcuI ACTAGT 1 cut(s) 419
BfaI CTAG 1 cut(s) 420
BfmI CTRYAG 1 cut(s) 219
BfoI RGCGCY 1 cut(s) 454
BisI GCNGC 4 cut(s) 131, 219, 222, 293
BlsI GCNGC 4 cut(s) 132, 220, 223, 294
Bme1390I CCNGG 2 cut(s) 276, 353
BmgT120I GGNCC 1 cut(s) 86
BmiI GGNNCC 1 cut(s) 9
BmrFI CCNGG 2 cut(s) 276, 353
BmsI GCATC 1 cut(s) 202
BsaJI CCNNGG 3 cut(s) 153, 352, 454
Bsc4I CCNNNNNNNGG 1 cut(s) 358
Bse1I ACTGG 1 cut(s) 70
Bse21I CCTNAGG 1 cut(s) 173
BseBI CCWGG 2 cut(s) 276, 353
BseDI CCNNGG 3 cut(s) 153, 352, 454
BseGI GGATG 2 cut(s) 99, 232
BseLI CCNNNNNNNGG 1 cut(s) 358
BseMII CTCAG 1 cut(s) 187
BseNI ACTGG 1 cut(s) 70
BseXI GCAGC 3 cut(s) 142, 205, 233
BsgI GTGCAG 1 cut(s) 149
Bsh1236I CGCG 1 cut(s) 292
BshFI GGCC 1 cut(s) 88
BslFI GGGAC 1 cut(s) 318
BslI CCNNNNNNNGG 1 cut(s) 358
BsmFI GGGAC 1 cut(s) 318
BsmI GAATGC 2 cut(s) 164, 266
BsnI GGCC 1 cut(s) 88
Bsp143I GATC 4 cut(s) 30, 79, 96, 367
Bsp19I CCATGG 1 cut(s) 454
BspACI CCGC 2 cut(s) 236, 292
BspANI GGCC 1 cut(s) 88
BspCNI CTCAG 1 cut(s) 186
BspFNI CGCG 1 cut(s) 292
BspLI GGNNCC 1 cut(s) 9
BspMAI CTGCAG 1 cut(s) 223
BspPI GGATC 3 cut(s) 87, 104, 362
BsrI ACTGG 1 cut(s) 70
BssECI CCNNGG 3 cut(s) 153, 352, 454
BssMI GATC 4 cut(s) 30, 79, 96, 367
BssT1I CCWWGG 1 cut(s) 454
Bst2UI CCWGG 2 cut(s) 276, 353
Bst4CI ACNGT 1 cut(s) 480
BstDEI CTNAG 1 cut(s) 173
BstDSI CCRYGG 2 cut(s) 153, 454
BstF5I GGATG 2 cut(s) 99, 232
BstFNI CGCG 1 cut(s) 292
BstH2I RGCGCY 1 cut(s) 454
BstHHI GCGC 1 cut(s) 453
BstKTI GATC 4 cut(s) 33, 82, 99, 370
BstMBI GATC 4 cut(s) 30, 79, 96, 367
BstNI CCWGG 2 cut(s) 276, 353
BstNSI RCATGY 1 cut(s) 242
BstSCI CCNGG 2 cut(s) 274, 351
BstSFI CTRYAG 1 cut(s) 219
BstUI CGCG 1 cut(s) 292
BstV1I GCAGC 3 cut(s) 142, 205, 233
BstX2I RGATCY 1 cut(s) 79
BstYI RGATCY 1 cut(s) 79
Bsu36I CCTNAGG 1 cut(s) 173
BsuRI GGCC 1 cut(s) 88
BtgI CCRYGG 2 cut(s) 153, 454
BtsCI GGATG 2 cut(s) 99, 232
CfoI GCGC 1 cut(s) 453
Cfr13I GGNCC 1 cut(s) 86
CviAII CATG 2 cut(s) 239, 455
CviJI RGCY 6 cut(s) 10, 88, 133, 147, 218, 224
CviKI_1 RGCY 6 cut(s) 10, 88, 133, 147, 218, 224
DdeI CTNAG 1 cut(s) 173
DpnI GATC 4 cut(s) 32, 81, 98, 369
DpnII GATC 4 cut(s) 30, 79, 96, 367
Eco130I CCWWGG 1 cut(s) 454
Eco81I CCTNAGG 1 cut(s) 173
EcoRII CCWGG 2 cut(s) 274, 351
EcoT14I CCWWGG 1 cut(s) 454
ErhI CCWWGG 1 cut(s) 454
FaeI CATG 2 cut(s) 242, 458
FaiI YATR 8 cut(s) 63, 240, 251, 317, 330, 387, 429, 456
FaqI GGGAC 1 cut(s) 318
FatI CATG 2 cut(s) 238, 454
FbaI TGATCA 1 cut(s) 30
Fnu4HI GCNGC 4 cut(s) 131, 219, 222, 293
FokI GGATG 2 cut(s) 86, 219
Fsp4HI GCNGC 4 cut(s) 131, 219, 222, 293
FspBI CTAG 1 cut(s) 420
GlaI GCGC 1 cut(s) 452
GluI GCNGC 4 cut(s) 131, 219, 222, 293
HaeII RGCGCY 1 cut(s) 454
HaeIII GGCC 1 cut(s) 88
HhaI GCGC 1 cut(s) 453
Hin1II CATG 2 cut(s) 242, 458
Hin6I GCGC 1 cut(s) 451
HinP1I GCGC 1 cut(s) 451
HinfI GANTC 1 cut(s) 279
HphI GGTGA 1 cut(s) 160
Hpy188I TCNGA 1 cut(s) 115
Hpy188III TCNNGA 2 cut(s) 140, 197
HpyAV CCTTC 4 cut(s) 137, 146, 295, 351
HpyCH4III ACNGT 1 cut(s) 480
HpyCH4IV ACGT 1 cut(s) 118
HpyCH4V TGCA 4 cut(s) 47, 130, 164, 221
HpyF3I CTNAG 1 cut(s) 173
HpySE526I ACGT 1 cut(s) 118
Hsp92II CATG 2 cut(s) 242, 458
HspAI GCGC 1 cut(s) 451
Ksp22I TGATCA 1 cut(s) 30
Kzo9I GATC 4 cut(s) 30, 79, 96, 367
LmnI GCTCC 2 cut(s) 7, 138
LpnPI CCDG 7 cut(s) 51, 160, 261, 288, 338, 365, 449
Lsp1109I GCAGC 3 cut(s) 142, 205, 233
LweI GCATC 1 cut(s) 202
MaeI CTAG 1 cut(s) 420
MaeII ACGT 1 cut(s) 118
MalI GATC 4 cut(s) 32, 81, 98, 369
MboI GATC 4 cut(s) 30, 79, 96, 367
MflI RGATCY 1 cut(s) 79
MluCI AATT 3 cut(s) 245, 409, 440
MnlI CCTC 3 cut(s) 182, 205, 291
MroXI GAANNNNTTC 1 cut(s) 324
MseI TTAA 1 cut(s) 348
MslI CAYNNNNRTG 2 cut(s) 42, 237
MspR9I CCNGG 2 cut(s) 276, 353
Mva1269I GAATGC 2 cut(s) 164, 266
MvaI CCWGG 2 cut(s) 276, 353
MvnI CGCG 1 cut(s) 292
NcoI CCATGG 1 cut(s) 454
NdeII GATC 4 cut(s) 30, 79, 96, 367
NlaIII CATG 2 cut(s) 242, 458
NlaIV GGNNCC 1 cut(s) 9
NmeAIII GCCGAG 1 cut(s) 250
NspI RCATGY 1 cut(s) 242
PctI GAATGC 2 cut(s) 164, 266
PdmI GAANNNNTTC 1 cut(s) 324
PfeI GAWTC 1 cut(s) 279
PfoI TCCNGGA 1 cut(s) 274
PkrI GCNGC 4 cut(s) 132, 220, 223, 294
Psp6I CCWGG 2 cut(s) 274, 351
PspGI CCWGG 2 cut(s) 274, 351
PspN4I GGNNCC 1 cut(s) 9
PspPI GGNCC 1 cut(s) 86
PstI CTGCAG 1 cut(s) 223
PsuI RGATCY 1 cut(s) 79
RseI CAYNNNNRTG 2 cut(s) 42, 237
SaqAI TTAA 1 cut(s) 348
SatI GCNGC 4 cut(s) 131, 219, 222, 293
Sau3AI GATC 4 cut(s) 30, 79, 96, 367
Sau96I GGNCC 1 cut(s) 86
ScrFI CCNGG 2 cut(s) 276, 353
SetI ASST 6 cut(s) 121, 135, 179, 220, 406, 468
SfaNI GCATC 1 cut(s) 202
SfcI CTRYAG 1 cut(s) 219
SmiMI CAYNNNNRTG 2 cut(s) 42, 237
SpeI ACTAGT 1 cut(s) 419
Sse9I AATT 3 cut(s) 245, 409, 440
SsiI CCGC 2 cut(s) 236, 292
SspI AATATT 2 cut(s) 324, 376
SspMI CTAG 1 cut(s) 420
StyD4I CCNGG 2 cut(s) 274, 351
StyI CCWWGG 1 cut(s) 454
TaaI ACNGT 1 cut(s) 480
TaiI ACGT 1 cut(s) 121
TasI AATT 3 cut(s) 245, 409, 440
TauI GCSGC 1 cut(s) 295
TfiI GAWTC 1 cut(s) 279
Tru1I TTAA 1 cut(s) 348
Tru9I TTAA 1 cut(s) 348
TseI GCWGC 3 cut(s) 130, 218, 221
TspDTI ATGAA 2 cut(s) 221, 317
TspGWI ACGGA 1 cut(s) 32
XapI RAATTY 2 cut(s) 245, 440
XceI RCATGY 1 cut(s) 242
XmnI GAANNNNTTC 1 cut(s) 324
XspI CTAG 1 cut(s) 420
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.