FvH4_4g32920

Plant protein 1589 of unknown function (A_thal_3526)

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb4
Physical Location & Seq
Reverse (-)
31345461 .. 31346699
1239 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_4g32920.t1

Sequence Viewer

Length: 309 bp
ATGCATCAGCATAACCATCTCCTAGGGCGTCCATGCTTGCATTGCCACCCACACACTTACATTAGAATGGTTCAACATCTTATTGAGAAATGCTTACTCTTTCACATGAGTCGTGACCAGTGCATAAACGCCTTAGCACGGCATGCAAACATTACACCACTCATCACACTTACAGTTTGGAGAGAGCTACAAAAAGAGAATAGGCACTTCTTTCAAGCATATTTCAACTCTATTTCTCCCACCAGGTCTTCAATGAGAAGCCATATTCAAAACGCACCAAGATTTGCAGGAAGGAGATACTGGAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

103

Amino Acids

12.3

Weight (kDa)

10.57

Isoelectric Point (pI)

68.36

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
A_thal_3526 PF09713 24 - 74 3.3e-24 Plant protein 1589 of unknown function (A_thal_3526)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014237)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcyI GRCGYC 1 cut(s) 28
AfiI CCNNNNNNNGG 1 cut(s) 138
AgsI TTSAA 5 cut(s) 74, 215, 226, 252, 269
AjnI CCWGG 1 cut(s) 242
AluBI AGCT 1 cut(s) 187
AluI AGCT 1 cut(s) 187
AspA2I CCTAGG 1 cut(s) 22
AvrII CCTAGG 1 cut(s) 22
BbsI GAAGAC 1 cut(s) 240
BccI CCATC 1 cut(s) 24
BceAI ACGGC 1 cut(s) 155
BciT130I CCWGG 1 cut(s) 244
BfaI CTAG 1 cut(s) 23
BlnI CCTAGG 1 cut(s) 22
Bme1390I CCNGG 1 cut(s) 244
BmrFI CCNGG 1 cut(s) 244
BmsI GCATC 1 cut(s) 13
BpiI GAAGAC 1 cut(s) 240
Bpu10I CCTNAGC 1 cut(s) 133
BsaHI GRCGYC 1 cut(s) 28
BsaJI CCNNGG 1 cut(s) 22
Bsc4I CCNNNNNNNGG 1 cut(s) 138
Bse1I ACTGG 2 cut(s) 118, 305
Bse3DI GCAATG 1 cut(s) 40
BseBI CCWGG 1 cut(s) 244
BseDI CCNNGG 1 cut(s) 22
BseLI CCNNNNNNNGG 1 cut(s) 138
BseMI GCAATG 1 cut(s) 40
BseNI ACTGG 2 cut(s) 118, 305
BslI CCNNNNNNNGG 1 cut(s) 138
BsrDI GCAATG 1 cut(s) 40
BsrI ACTGG 2 cut(s) 118, 305
BssECI CCNNGG 1 cut(s) 22
BssNI GRCGYC 1 cut(s) 28
BssT1I CCWWGG 1 cut(s) 22
Bst2UI CCWGG 1 cut(s) 244
Bst4CI ACNGT 1 cut(s) 175
BstACI GRCGYC 1 cut(s) 28
BstAPI GCANNNNNTGC 1 cut(s) 143
BstC8I GCNNGC 2 cut(s) 38, 144
BstDEI CTNAG 1 cut(s) 133
BstMWI GCNNNNNNNGC 2 cut(s) 42, 143
BstNI CCWGG 1 cut(s) 244
BstNSI RCATGY 1 cut(s) 146
BstSCI CCNGG 1 cut(s) 242
BstV2I GAAGAC 1 cut(s) 240
BtsIMutI CAGTG 1 cut(s) 125
Cac8I GCNNGC 2 cut(s) 38, 144
CseI GACGC 1 cut(s) 17
CsiI ACCWGGT 1 cut(s) 242
CviAII CATG 3 cut(s) 33, 106, 143
CviJI RGCY 2 cut(s) 187, 261
CviKI_1 RGCY 2 cut(s) 187, 261
DdeI CTNAG 1 cut(s) 133
Eco130I CCWWGG 1 cut(s) 22
EcoRII CCWGG 1 cut(s) 242
EcoT14I CCWWGG 1 cut(s) 22
EcoT22I ATGCAT 1 cut(s) 6
ErhI CCWWGG 1 cut(s) 22
FaeI CATG 3 cut(s) 36, 109, 146
FaiI YATR 7 cut(s) 12, 34, 107, 125, 144, 220, 264
FatI CATG 3 cut(s) 32, 105, 142
FspBI CTAG 1 cut(s) 23
HgaI GACGC 1 cut(s) 17
Hin1I GRCGYC 1 cut(s) 28
Hin1II CATG 3 cut(s) 36, 109, 146
HinfI GANTC 1 cut(s) 109
Hpy188III TCNNGA 1 cut(s) 113
HpyAV CCTTC 1 cut(s) 285
HpyCH4III ACNGT 1 cut(s) 175
HpyCH4V TGCA 5 cut(s) 4, 40, 123, 146, 287
HpyF10VI GCNNNNNNNGC 2 cut(s) 42, 143
HpyF3I CTNAG 1 cut(s) 133
Hsp92I GRCGYC 1 cut(s) 28
Hsp92II CATG 3 cut(s) 36, 109, 146
LpnPI CCDG 5 cut(s) 131, 229, 256, 273, 286
LweI GCATC 1 cut(s) 13
MabI ACCWGGT 1 cut(s) 242
MaeI CTAG 1 cut(s) 23
MaeIII GTNAC 1 cut(s) 113
MboII GAAGA 1 cut(s) 240
MlyI GAGTC 1 cut(s) 118
Mph1103I ATGCAT 1 cut(s) 6
MslI CAYNNNNRTG 1 cut(s) 65
MspR9I CCNGG 1 cut(s) 244
MvaI CCWGG 1 cut(s) 244
MwoI GCNNNNNNNGC 2 cut(s) 42, 143
NlaIII CATG 3 cut(s) 36, 109, 146
NmuCI GTSAC 1 cut(s) 113
NsiI ATGCAT 1 cut(s) 6
NspI RCATGY 1 cut(s) 146
PaeI GCATGC 1 cut(s) 146
PleI GAGTC 1 cut(s) 117
PpsI GAGTC 1 cut(s) 117
Psp6I CCWGG 1 cut(s) 242
PspGI CCWGG 1 cut(s) 242
RseI CAYNNNNRTG 1 cut(s) 65
SchI GAGTC 1 cut(s) 118
ScrFI CCNGG 1 cut(s) 244
SetI ASST 2 cut(s) 189, 248
SexAI ACCWGGT 1 cut(s) 242
SfaNI GCATC 1 cut(s) 13
SmiMI CAYNNNNRTG 1 cut(s) 65
SphI GCATGC 1 cut(s) 146
SspMI CTAG 1 cut(s) 23
StyD4I CCNGG 1 cut(s) 242
StyI CCWWGG 1 cut(s) 22
TaaI ACNGT 1 cut(s) 175
TscAI CASTG 1 cut(s) 125
TseFI GTSAC 1 cut(s) 113
Tsp45I GTSAC 1 cut(s) 113
TspRI CASTG 1 cut(s) 125
XceI RCATGY 1 cut(s) 146
XmaJI CCTAGG 1 cut(s) 22
XspI CTAG 1 cut(s) 23
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.