Rw4G033600

Plant protein 1589 of unknown function (A_thal_3526)

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr4
Physical Location & Seq
Reverse (-)
60724044 .. 60724986
943 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw4G033600.1

Sequence Viewer

Length: 309 bp
ATGCGTCAGCATAACCATCTCCTGGGGCGTCCATGCTTGCATTGCCACCCCCACAGCTACATTAGGATGGTTCAACATCTTATTGAGAAATGCCTACTCTTTCACATGAGTCGTGACCAATGCATAAAGGCCTTAGCACAGCATGCAAATATTACACCACTTATCACACTTACAGTGTGGAGAGAGCTACAGAAAGAGAATAGGCACTTCTTTCAAGCATATTTCCACTCTATTTATCCCACCAGGCCTTTAATGAGAAGCCATATTCAAAATGCGCCAAGATTTTCAGGAAGGAAATACTGGAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

102

Amino Acids

12.41

Weight (kDa)

10.3

Isoelectric Point (pI)

49.63

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
A_thal_3526 PF09713 24 - 74 2.9e-24 Plant protein 1589 of unknown function (A_thal_3526)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014237)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 22
AcyI GRCGYC 1 cut(s) 28
AfiI CCNNNNNNNGG 1 cut(s) 22
AgsI TTSAA 3 cut(s) 74, 215, 269
AjnI CCWGG 2 cut(s) 21, 242
AluBI AGCT 2 cut(s) 57, 187
AluI AGCT 2 cut(s) 57, 187
AoxI GGCC 2 cut(s) 129, 245
AspLEI GCGC 1 cut(s) 277
BccI CCATC 2 cut(s) 24, 61
BciT130I CCWGG 2 cut(s) 23, 244
BfmI CTRYAG 1 cut(s) 188
Bme1390I CCNGG 2 cut(s) 23, 244
BmrFI CCNGG 2 cut(s) 23, 244
Bpu10I CCTNAGC 1 cut(s) 133
BsaHI GRCGYC 1 cut(s) 28
BsaJI CCNNGG 1 cut(s) 22
Bsc4I CCNNNNNNNGG 1 cut(s) 22
Bse1I ACTGG 1 cut(s) 305
Bse3DI GCAATG 1 cut(s) 40
BseBI CCWGG 2 cut(s) 23, 244
BseDI CCNNGG 1 cut(s) 22
BseGI GGATG 1 cut(s) 72
BseLI CCNNNNNNNGG 1 cut(s) 22
BseMI GCAATG 1 cut(s) 40
BseNI ACTGG 1 cut(s) 305
BshFI GGCC 2 cut(s) 131, 247
BslI CCNNNNNNNGG 1 cut(s) 22
BsnI GGCC 2 cut(s) 131, 247
BspANI GGCC 2 cut(s) 131, 247
BsrDI GCAATG 1 cut(s) 40
BsrI ACTGG 1 cut(s) 305
BssECI CCNNGG 1 cut(s) 22
BssNI GRCGYC 1 cut(s) 28
Bst2UI CCWGG 2 cut(s) 23, 244
Bst4CI ACNGT 1 cut(s) 175
BstACI GRCGYC 1 cut(s) 28
BstAPI GCANNNNNTGC 1 cut(s) 143
BstC8I GCNNGC 2 cut(s) 38, 144
BstDEI CTNAG 1 cut(s) 133
BstF5I GGATG 1 cut(s) 72
BstHHI GCGC 1 cut(s) 277
BstMWI GCNNNNNNNGC 2 cut(s) 42, 143
BstNI CCWGG 2 cut(s) 23, 244
BstNSI RCATGY 1 cut(s) 146
BstSCI CCNGG 2 cut(s) 21, 242
BstSFI CTRYAG 1 cut(s) 188
BsuRI GGCC 2 cut(s) 131, 247
BtsCI GGATG 1 cut(s) 72
BtsIMutI CAGTG 1 cut(s) 180
Cac8I GCNNGC 2 cut(s) 38, 144
CfoI GCGC 1 cut(s) 277
CseI GACGC 1 cut(s) 17
CviAII CATG 3 cut(s) 33, 106, 143
CviJI RGCY 5 cut(s) 57, 131, 187, 247, 261
CviKI_1 RGCY 5 cut(s) 57, 131, 187, 247, 261
DdeI CTNAG 1 cut(s) 133
Eco147I AGGCCT 2 cut(s) 131, 247
EcoRII CCWGG 2 cut(s) 21, 242
EcoT22I ATGCAT 1 cut(s) 125
FaeI CATG 3 cut(s) 36, 109, 146
FaiI YATR 7 cut(s) 12, 34, 107, 125, 144, 220, 264
FatI CATG 3 cut(s) 32, 105, 142
FokI GGATG 1 cut(s) 79
GlaI GCGC 1 cut(s) 276
HaeIII GGCC 2 cut(s) 131, 247
HgaI GACGC 1 cut(s) 17
HhaI GCGC 1 cut(s) 277
Hin1I GRCGYC 1 cut(s) 28
Hin1II CATG 3 cut(s) 36, 109, 146
Hin6I GCGC 1 cut(s) 275
HinP1I GCGC 1 cut(s) 275
HinfI GANTC 1 cut(s) 109
Hpy188III TCNNGA 2 cut(s) 113, 288
HpyAV CCTTC 1 cut(s) 285
HpyCH4III ACNGT 1 cut(s) 175
HpyCH4V TGCA 3 cut(s) 40, 123, 146
HpyF10VI GCNNNNNNNGC 2 cut(s) 42, 143
HpyF3I CTNAG 1 cut(s) 133
Hsp92I GRCGYC 1 cut(s) 28
Hsp92II CATG 3 cut(s) 36, 109, 146
HspAI GCGC 1 cut(s) 275
LpnPI CCDG 6 cut(s) 8, 35, 229, 256, 273, 286
MaeIII GTNAC 1 cut(s) 113
MlyI GAGTC 1 cut(s) 118
Mph1103I ATGCAT 1 cut(s) 125
MseI TTAA 1 cut(s) 251
MslI CAYNNNNRTG 1 cut(s) 65
MspR9I CCNGG 2 cut(s) 23, 244
MvaI CCWGG 2 cut(s) 23, 244
MwoI GCNNNNNNNGC 2 cut(s) 42, 143
NlaIII CATG 3 cut(s) 36, 109, 146
NmuCI GTSAC 1 cut(s) 113
NsiI ATGCAT 1 cut(s) 125
NspI RCATGY 1 cut(s) 146
PaeI GCATGC 1 cut(s) 146
PceI AGGCCT 2 cut(s) 131, 247
PflMI CCANNNNNTGG 1 cut(s) 22
PleI GAGTC 1 cut(s) 117
PpsI GAGTC 1 cut(s) 117
Psp6I CCWGG 2 cut(s) 21, 242
PspGI CCWGG 2 cut(s) 21, 242
RseI CAYNNNNRTG 1 cut(s) 65
SaqAI TTAA 1 cut(s) 251
SchI GAGTC 1 cut(s) 118
ScrFI CCNGG 2 cut(s) 23, 244
SetI ASST 2 cut(s) 59, 189
SfcI CTRYAG 1 cut(s) 188
SmiMI CAYNNNNRTG 1 cut(s) 65
SphI GCATGC 1 cut(s) 146
SseBI AGGCCT 2 cut(s) 131, 247
SspI AATATT 1 cut(s) 151
StuI AGGCCT 2 cut(s) 131, 247
StyD4I CCNGG 2 cut(s) 21, 242
TaaI ACNGT 1 cut(s) 175
Tru1I TTAA 1 cut(s) 251
Tru9I TTAA 1 cut(s) 251
TscAI CASTG 1 cut(s) 180
TseFI GTSAC 1 cut(s) 113
Tsp45I GTSAC 1 cut(s) 113
TspRI CASTG 1 cut(s) 180
Van91I CCANNNNNTGG 1 cut(s) 22
XceI RCATGY 1 cut(s) 146
Zsp2I ATGCAT 1 cut(s) 125
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.