Prupe.1G250400_v2.0.a1

Plant protein 1589 of unknown function (A_thal_3526)

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
Physical Location & Seq
Forward (+)
26246634 .. 26247836
1203 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G250400.1

Sequence Viewer

Length: 297 bp
ATGTATCACAACCATCACCTCGGTCCATGTTTGCTTTGCAACCCTCACAGCTACATAAGAATGGTTCAACATCTTATAGAGAGATGCTTGTTACTTCACATGAGTTGTGACCAGTGCATAAAGGCGCTAGCAGAGCATGCAAGCATTAGGCCAATTGTCACGCTTACAGTGTGGAGAGAGCTACAAAAGGAGAATAGGCACTTCTTTCAAGCTTATTTCCACTCTATCTCTCCCAGGCCTTTAATGGGTAGTTATATTCAAAGGGGGCCAAGATTTGCAAGAAGGAAACACTACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

99

Amino Acids

11.75

Weight (kDa)

9.72

Isoelectric Point (pI)

49.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014237)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 245
AgsI TTSAA 3 cut(s) 68, 209, 260
AjnI CCWGG 1 cut(s) 233
AluBI AGCT 3 cut(s) 51, 181, 212
AluI AGCT 3 cut(s) 51, 181, 212
AoxI GGCC 3 cut(s) 149, 236, 266
AspLEI GCGC 1 cut(s) 127
AspS9I GGNCC 2 cut(s) 23, 266
AsuHPI GGTGA 1 cut(s) 8
AsuNHI GCTAGC 1 cut(s) 127
AvaII GGWCC 1 cut(s) 23
BccI CCATC 1 cut(s) 21
BciT130I CCWGG 1 cut(s) 235
BfaI CTAG 1 cut(s) 128
BfoI RGCGCY 1 cut(s) 128
Bme1390I CCNGG 1 cut(s) 235
Bme18I GGWCC 1 cut(s) 23
BmgT120I GGNCC 2 cut(s) 23, 266
BmiI GGNNCC 1 cut(s) 267
BmrFI CCNGG 1 cut(s) 235
BmsI GCATC 1 cut(s) 74
BmtI GCTAGC 1 cut(s) 131
BsaJI CCNNGG 2 cut(s) 19, 233
Bsc4I CCNNNNNNNGG 1 cut(s) 245
Bse1I ACTGG 1 cut(s) 112
BseBI CCWGG 1 cut(s) 235
BseDI CCNNGG 2 cut(s) 19, 233
BseLI CCNNNNNNNGG 1 cut(s) 245
BseNI ACTGG 1 cut(s) 112
BshFI GGCC 3 cut(s) 151, 238, 268
BslI CCNNNNNNNGG 1 cut(s) 245
BsnI GGCC 3 cut(s) 151, 238, 268
BspANI GGCC 3 cut(s) 151, 238, 268
BspLI GGNNCC 1 cut(s) 267
BspOI GCTAGC 1 cut(s) 131
BsrI ACTGG 1 cut(s) 112
BssECI CCNNGG 2 cut(s) 19, 233
Bst2UI CCWGG 1 cut(s) 235
Bst4CI ACNGT 1 cut(s) 169
BstAPI GCANNNNNTGC 1 cut(s) 137
BstC8I GCNNGC 3 cut(s) 129, 138, 142
BstH2I RGCGCY 1 cut(s) 128
BstHHI GCGC 1 cut(s) 127
BstMWI GCNNNNNNNGC 2 cut(s) 133, 137
BstNI CCWGG 1 cut(s) 235
BstNSI RCATGY 1 cut(s) 140
BstSCI CCNGG 1 cut(s) 233
BsuRI GGCC 3 cut(s) 151, 238, 268
BtsIMutI CAGTG 2 cut(s) 119, 174
Cac8I GCNNGC 3 cut(s) 129, 138, 142
CfoI GCGC 1 cut(s) 127
Cfr13I GGNCC 2 cut(s) 23, 266
CviAII CATG 3 cut(s) 27, 100, 137
CviJI RGCY 6 cut(s) 51, 151, 181, 212, 238, 268
CviKI_1 RGCY 6 cut(s) 51, 151, 181, 212, 238, 268
Eco147I AGGCCT 1 cut(s) 238
Eco47I GGWCC 1 cut(s) 23
EcoRII CCWGG 1 cut(s) 233
FaeI CATG 3 cut(s) 30, 103, 140
FaiI YATR 7 cut(s) 28, 56, 77, 101, 119, 138, 255
FatI CATG 3 cut(s) 26, 99, 136
FspBI CTAG 1 cut(s) 128
GlaI GCGC 1 cut(s) 126
HaeII RGCGCY 1 cut(s) 128
HaeIII GGCC 3 cut(s) 151, 238, 268
HhaI GCGC 1 cut(s) 127
Hin1II CATG 3 cut(s) 30, 103, 140
Hin6I GCGC 1 cut(s) 125
HinP1I GCGC 1 cut(s) 125
HindIII AAGCTT 1 cut(s) 210
HphI GGTGA 1 cut(s) 8
HpyAV CCTTC 1 cut(s) 276
HpyCH4III ACNGT 1 cut(s) 169
HpyCH4V TGCA 4 cut(s) 39, 117, 140, 278
HpyF10VI GCNNNNNNNGC 2 cut(s) 133, 137
Hsp92II CATG 3 cut(s) 30, 103, 140
HspAI GCGC 1 cut(s) 125
LpnPI CCDG 3 cut(s) 125, 220, 247
LweI GCATC 1 cut(s) 74
MaeI CTAG 1 cut(s) 128
MaeIII GTNAC 3 cut(s) 90, 107, 157
MfeI CAATTG 1 cut(s) 153
MluCI AATT 1 cut(s) 153
MnlI CCTC 2 cut(s) 29, 54
MseI TTAA 1 cut(s) 242
MslI CAYNNNNRTG 1 cut(s) 59
MspR9I CCNGG 1 cut(s) 235
MunI CAATTG 1 cut(s) 153
MvaI CCWGG 1 cut(s) 235
MwoI GCNNNNNNNGC 2 cut(s) 133, 137
NheI GCTAGC 1 cut(s) 127
NlaIII CATG 3 cut(s) 30, 103, 140
NlaIV GGNNCC 1 cut(s) 267
NmuCI GTSAC 2 cut(s) 107, 157
NspI RCATGY 1 cut(s) 140
PaeI GCATGC 1 cut(s) 140
PceI AGGCCT 1 cut(s) 238
Psp6I CCWGG 1 cut(s) 233
PspGI CCWGG 1 cut(s) 233
PspN4I GGNNCC 1 cut(s) 267
PspPI GGNCC 2 cut(s) 23, 266
RseI CAYNNNNRTG 1 cut(s) 59
SaqAI TTAA 1 cut(s) 242
Sau96I GGNCC 2 cut(s) 23, 266
ScrFI CCNGG 1 cut(s) 235
SetI ASST 4 cut(s) 21, 53, 183, 214
SfaNI GCATC 1 cut(s) 74
SinI GGWCC 1 cut(s) 23
SmiMI CAYNNNNRTG 1 cut(s) 59
SphI GCATGC 1 cut(s) 140
Sse9I AATT 1 cut(s) 153
SseBI AGGCCT 1 cut(s) 238
SspMI CTAG 1 cut(s) 128
StuI AGGCCT 1 cut(s) 238
StyD4I CCNGG 1 cut(s) 233
TaaI ACNGT 1 cut(s) 169
TaqII GACCGA 1 cut(s) 11
TasI AATT 1 cut(s) 153
Tru1I TTAA 1 cut(s) 242
Tru9I TTAA 1 cut(s) 242
TscAI CASTG 2 cut(s) 119, 174
TseFI GTSAC 2 cut(s) 107, 157
Tsp45I GTSAC 2 cut(s) 107, 157
TspRI CASTG 2 cut(s) 119, 174
VpaK11BI GGWCC 1 cut(s) 23
XceI RCATGY 1 cut(s) 140
XcmI CCANNNNNNNNNTGG 1 cut(s) 241
XspI CTAG 1 cut(s) 128
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.