MD16G1096100.v1.1

Plant protein 1589 of unknown function (A_thal_3526)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr16
OG0014237
Physical Location & Seq
Reverse (-)
6678912 .. 6681196
2285 bp
Loading structure...
UTR
Exon/CDS
Intron
MD16G1096100.v1.1.491

Sequence Viewer

Length: 297 bp
ATGTATCACAGTCATCACTTTGGTCCATGTCTGCATTGCCACTCTCAAAGCTACATTAGAATGGTTCAACATCTTATTGAGAGATGCTTGCTACTTCAAATGAGTCGTGACCAATGCGTAAAGGTGTTAGCAGAGCATGCAAGCATTAGGCCACTCGTCACGCTTACAGTGTGGAGAGAGCTACAAAAAGAGAATAGGCACTTCTTCCAAGCATACTTCCACTCAATTTCTCCCAGGCCTTTAATAGGCAGTTATATTCAAAGGCGGGCAAGATTTGGAAGAAGGAAACAGTACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
A_thal_3526

Protein Analysis

99

Amino Acids

11.87

Weight (kDa)

10.23

Isoelectric Point (pI)

60.59

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
A_thal_3526 PF09713 22 - 72 1.8e-23 Plant protein 1589 of unknown function (A_thal_3526)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014237)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G10657 AT1G10657 AT1G10657 AT1G10657
fragaria_vesca FvH4_4g32920
malus_domestica MD13G1095000.v1.1 MD16G1096100.v1.1
prunus_persica Prupe.1G250400_v2.0.a1
pyrus_communis pycom13g08280
rosa_chinensis RchiOBHm_Chr4g0441951
rosa_multiflora Rmu_sc0002501.1_g000031 Rmu_sc0011990.1_g000009
rosa_roxburghii Rroxscaffold_5G00382780
rosa_rugosa Rorug04G0337100 Rorug04G0337200
rosa_samantha Rh4AG389100
rosa_wichuraiana Rw4G033600

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 265
AfaI GTAC 1 cut(s) 293
AfiI CCNNNNNNNGG 1 cut(s) 245
AgsI TTSAA 3 cut(s) 68, 98, 260
AjnI CCWGG 1 cut(s) 233
AluBI AGCT 2 cut(s) 51, 181
AluI AGCT 2 cut(s) 51, 181
AoxI GGCC 2 cut(s) 149, 236
AspS9I GGNCC 1 cut(s) 23
AvaII GGWCC 1 cut(s) 23
BciT130I CCWGG 1 cut(s) 235
BfaI CTAG 1 cut(s) 295
BmcAI AGTACT 1 cut(s) 293
Bme1390I CCNGG 1 cut(s) 235
Bme18I GGWCC 1 cut(s) 23
BmgT120I GGNCC 1 cut(s) 23
BmrFI CCNGG 1 cut(s) 235
BmsI GCATC 1 cut(s) 74
BsaJI CCNNGG 1 cut(s) 233
Bsc4I CCNNNNNNNGG 1 cut(s) 245
Bse3DI GCAATG 1 cut(s) 34
BseBI CCWGG 1 cut(s) 235
BseDI CCNNGG 1 cut(s) 233
BseLI CCNNNNNNNGG 1 cut(s) 245
BseMI GCAATG 1 cut(s) 34
BshFI GGCC 2 cut(s) 151, 238
BslI CCNNNNNNNGG 1 cut(s) 245
BsnI GGCC 2 cut(s) 151, 238
BspACI CCGC 1 cut(s) 265
BspANI GGCC 2 cut(s) 151, 238
BsrDI GCAATG 1 cut(s) 34
BssECI CCNNGG 1 cut(s) 233
Bst2UI CCWGG 1 cut(s) 235
Bst4CI ACNGT 3 cut(s) 11, 169, 291
BstAPI GCANNNNNTGC 1 cut(s) 137
BstC8I GCNNGC 4 cut(s) 89, 138, 142, 267
BstENI CCTNNNNNAGG 1 cut(s) 243
BstMWI GCNNNNNNNGC 1 cut(s) 137
BstNI CCWGG 1 cut(s) 235
BstNSI RCATGY 1 cut(s) 140
BstSCI CCNGG 1 cut(s) 233
BsuRI GGCC 2 cut(s) 151, 238
BtsIMutI CAGTG 1 cut(s) 174
Cac8I GCNNGC 4 cut(s) 89, 138, 142, 267
Cfr13I GGNCC 1 cut(s) 23
Csp6I GTAC 1 cut(s) 292
CviAII CATG 2 cut(s) 27, 137
CviJI RGCY 4 cut(s) 51, 151, 181, 238
CviKI_1 RGCY 4 cut(s) 51, 151, 181, 238
CviQI GTAC 1 cut(s) 292
Eco147I AGGCCT 1 cut(s) 238
Eco47I GGWCC 1 cut(s) 23
EcoNI CCTNNNNNAGG 1 cut(s) 243
EcoRII CCWGG 1 cut(s) 233
FaeI CATG 2 cut(s) 30, 140
FaiI YATR 4 cut(s) 28, 138, 214, 255
FatI CATG 2 cut(s) 26, 136
FauI CCCGC 1 cut(s) 258
FspBI CTAG 1 cut(s) 295
HaeIII GGCC 2 cut(s) 151, 238
Hin1II CATG 2 cut(s) 30, 140
HinfI GANTC 1 cut(s) 103
Hpy188III TCNNGA 1 cut(s) 107
HpyAV CCTTC 1 cut(s) 276
HpyCH4III ACNGT 3 cut(s) 11, 169, 291
HpyCH4V TGCA 2 cut(s) 34, 140
HpyF10VI GCNNNNNNNGC 1 cut(s) 137
Hsp92II CATG 2 cut(s) 30, 140
LpnPI CCDG 2 cut(s) 220, 247
LweI GCATC 1 cut(s) 74
MaeI CTAG 1 cut(s) 295
MaeIII GTNAC 2 cut(s) 107, 157
MboII GAAGA 2 cut(s) 196, 291
MluCI AATT 1 cut(s) 225
MlyI GAGTC 1 cut(s) 112
MseI TTAA 1 cut(s) 242
MslI CAYNNNNRTG 1 cut(s) 59
MspR9I CCNGG 1 cut(s) 235
MvaI CCWGG 1 cut(s) 235
MwoI GCNNNNNNNGC 1 cut(s) 137
NlaIII CATG 2 cut(s) 30, 140
NmuCI GTSAC 2 cut(s) 107, 157
NspI RCATGY 1 cut(s) 140
PaeI GCATGC 1 cut(s) 140
PceI AGGCCT 1 cut(s) 238
PleI GAGTC 1 cut(s) 111
PpsI GAGTC 1 cut(s) 111
Psp6I CCWGG 1 cut(s) 233
PspGI CCWGG 1 cut(s) 233
PspPI GGNCC 1 cut(s) 23
RsaI GTAC 1 cut(s) 293
RsaNI GTAC 1 cut(s) 292
RseI CAYNNNNRTG 1 cut(s) 59
SaqAI TTAA 1 cut(s) 242
Sau96I GGNCC 1 cut(s) 23
ScaI AGTACT 1 cut(s) 293
SchI GAGTC 1 cut(s) 112
ScrFI CCNGG 1 cut(s) 235
SetI ASST 3 cut(s) 53, 126, 183
SfaNI GCATC 1 cut(s) 74
SinI GGWCC 1 cut(s) 23
SmiMI CAYNNNNRTG 1 cut(s) 59
SphI GCATGC 1 cut(s) 140
Sse9I AATT 1 cut(s) 225
SseBI AGGCCT 1 cut(s) 238
SsiI CCGC 1 cut(s) 265
SspMI CTAG 1 cut(s) 295
StuI AGGCCT 1 cut(s) 238
StyD4I CCNGG 1 cut(s) 233
TaaI ACNGT 3 cut(s) 11, 169, 291
TasI AATT 1 cut(s) 225
TatI WGTACW 1 cut(s) 291
Tru1I TTAA 1 cut(s) 242
Tru9I TTAA 1 cut(s) 242
TscAI CASTG 1 cut(s) 174
TseFI GTSAC 2 cut(s) 107, 157
Tsp45I GTSAC 2 cut(s) 107, 157
TspRI CASTG 1 cut(s) 174
VpaK11BI GGWCC 1 cut(s) 23
XagI CCTNNNNNAGG 1 cut(s) 243
XceI RCATGY 1 cut(s) 140
XspI CTAG 1 cut(s) 295
ZrmI AGTACT 1 cut(s) 293
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.