MD13G1095000.v1.1

Plant protein 1589 of unknown function (A_thal_3526)

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr13
Physical Location & Seq
Reverse (-)
6673258 .. 6674536
1279 bp
Loading structure...
UTR
Exon/CDS
Intron
MD13G1095000.v1.1.491

Sequence Viewer

Length: 303 bp
ATGCATCACAGTCATCACTTTGGTCCATGTCTGCATTGCCACCCTCAAAGCTACATTAGAATGGTTCAACATCTTATTGAGAGATGCTTGCTACTTCACATGAATCGTGACCAATGCATAAAGGTACTAGCAGAGCATGCACGCATTAGGCCCCTCGTTACGCTTACAGTATGGAGAGAGCTACAAAAGGAGAATAGGCACTTCTTCCAAGCATACTTCCACTCTATTTCTCCCAGACCTTTAATGGGCAGTTGTATTCAAAGGGGGCCAAGATTTGGAAGAAGGAAACAGCACTGGAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

101

Amino Acids

12.15

Weight (kDa)

10.56

Isoelectric Point (pI)

48.42

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
A_thal_3526 PF09713 22 - 72 1.4e-23 Plant protein 1589 of unknown function (A_thal_3526)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014237)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 275
AfaI GTAC 1 cut(s) 126
AfiI CCNNNNNNNGG 2 cut(s) 245, 275
AgsI TTSAA 2 cut(s) 68, 260
AluBI AGCT 2 cut(s) 51, 181
AluI AGCT 2 cut(s) 51, 181
AoxI GGCC 2 cut(s) 149, 266
AspS9I GGNCC 3 cut(s) 23, 150, 266
AvaII GGWCC 1 cut(s) 23
BfaI CTAG 1 cut(s) 128
Bme18I GGWCC 1 cut(s) 23
BmgT120I GGNCC 3 cut(s) 23, 150, 266
BmiI GGNNCC 2 cut(s) 152, 267
BmsI GCATC 2 cut(s) 13, 74
Bsc4I CCNNNNNNNGG 2 cut(s) 245, 275
Bse1I ACTGG 1 cut(s) 299
Bse3DI GCAATG 1 cut(s) 34
BseLI CCNNNNNNNGG 2 cut(s) 245, 275
BseMI GCAATG 1 cut(s) 34
BseNI ACTGG 1 cut(s) 299
BshFI GGCC 2 cut(s) 151, 268
BslI CCNNNNNNNGG 2 cut(s) 245, 275
BsnI GGCC 2 cut(s) 151, 268
BspANI GGCC 2 cut(s) 151, 268
BspLI GGNNCC 2 cut(s) 152, 267
BsrDI GCAATG 1 cut(s) 34
BsrI ACTGG 1 cut(s) 299
Bst4CI ACNGT 2 cut(s) 11, 169
BstAPI GCANNNNNTGC 1 cut(s) 137
BstC8I GCNNGC 3 cut(s) 89, 138, 142
BstMWI GCNNNNNNNGC 1 cut(s) 137
BstNSI RCATGY 1 cut(s) 140
BsuRI GGCC 2 cut(s) 151, 268
BtsIMutI CAGTG 1 cut(s) 292
Cac8I GCNNGC 3 cut(s) 89, 138, 142
Cfr13I GGNCC 3 cut(s) 23, 150, 266
Csp6I GTAC 1 cut(s) 125
CviAII CATG 3 cut(s) 27, 100, 137
CviJI RGCY 4 cut(s) 51, 151, 181, 268
CviKI_1 RGCY 4 cut(s) 51, 151, 181, 268
CviQI GTAC 1 cut(s) 125
Eco47I GGWCC 1 cut(s) 23
EcoO109I RGGNCCY 1 cut(s) 150
EcoT22I ATGCAT 2 cut(s) 6, 119
FaeI CATG 3 cut(s) 30, 103, 140
FaiI YATR 6 cut(s) 28, 101, 119, 138, 172, 214
FatI CATG 3 cut(s) 26, 99, 136
FspBI CTAG 1 cut(s) 128
HaeIII GGCC 2 cut(s) 151, 268
Hin1II CATG 3 cut(s) 30, 103, 140
HinfI GANTC 1 cut(s) 103
Hpy188III TCNNGA 1 cut(s) 107
HpyAV CCTTC 1 cut(s) 276
HpyCH4III ACNGT 2 cut(s) 11, 169
HpyCH4V TGCA 4 cut(s) 4, 34, 117, 140
HpyF10VI GCNNNNNNNGC 1 cut(s) 137
Hsp92II CATG 3 cut(s) 30, 103, 140
LpnPI CCDG 2 cut(s) 247, 280
LweI GCATC 2 cut(s) 13, 74
MaeI CTAG 1 cut(s) 128
MaeIII GTNAC 2 cut(s) 107, 157
MboII GAAGA 2 cut(s) 196, 291
MnlI CCTC 2 cut(s) 54, 164
Mph1103I ATGCAT 2 cut(s) 6, 119
MseI TTAA 1 cut(s) 242
MslI CAYNNNNRTG 1 cut(s) 59
MwoI GCNNNNNNNGC 1 cut(s) 137
NlaIII CATG 3 cut(s) 30, 103, 140
NlaIV GGNNCC 2 cut(s) 152, 267
NmuCI GTSAC 1 cut(s) 107
NsiI ATGCAT 2 cut(s) 6, 119
NspI RCATGY 1 cut(s) 140
PaeI GCATGC 1 cut(s) 140
PfeI GAWTC 1 cut(s) 103
PflMI CCANNNNNTGG 1 cut(s) 275
PspN4I GGNNCC 2 cut(s) 152, 267
PspPI GGNCC 3 cut(s) 23, 150, 266
RsaI GTAC 1 cut(s) 126
RsaNI GTAC 1 cut(s) 125
RseI CAYNNNNRTG 1 cut(s) 59
SaqAI TTAA 1 cut(s) 242
Sau96I GGNCC 3 cut(s) 23, 150, 266
SetI ASST 4 cut(s) 53, 126, 183, 241
SfaNI GCATC 2 cut(s) 13, 74
SinI GGWCC 1 cut(s) 23
SmiMI CAYNNNNRTG 1 cut(s) 59
SphI GCATGC 1 cut(s) 140
SspMI CTAG 1 cut(s) 128
TaaI ACNGT 2 cut(s) 11, 169
TfiI GAWTC 1 cut(s) 103
Tru1I TTAA 1 cut(s) 242
Tru9I TTAA 1 cut(s) 242
TscAI CASTG 1 cut(s) 299
TseFI GTSAC 1 cut(s) 107
Tsp45I GTSAC 1 cut(s) 107
TspDTI ATGAA 1 cut(s) 116
TspRI CASTG 1 cut(s) 299
Van91I CCANNNNNTGG 1 cut(s) 275
VpaK11BI GGWCC 1 cut(s) 23
XceI RCATGY 1 cut(s) 140
XcmI CCANNNNNNNNNTGG 1 cut(s) 241
XspI CTAG 1 cut(s) 128
Zsp2I ATGCAT 2 cut(s) 6, 119
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.