Rh4AG389100

Plant protein 1589 of unknown function (A_thal_3526)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
OG0014237
Physical Location & Seq
Reverse (-)
69562599 .. 69564248
1650 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG389100.1

Sequence Viewer

Length: 279 bp
ATGCATCAGCATAACCATCTCCTGGGGCGTCCATGCTTGCATTGCCACCCCCACAGCTACATTAGGATGGTTCAACATCTTATTGAGAAATGCTTACTCTTTCACATGAGTCGTGACCAATGCATAAAGGCCTTAGCACAGCATGCAAATATTACACCACTTATCACACTTACAGTGTGGAGAGAGCTACAGAAAGAGAATAGGCACTTCTTTCAAGCATATTTCCACTCTATTTATCCCACCAGGCCTTTAATGAGTAAGACCTTCATAGCTAGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
A_thal_3526

Protein Analysis

92

Amino Acids

11.01

Weight (kDa)

9.56

Isoelectric Point (pI)

56.12

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
A_thal_3526 PF09713 24 - 74 2.2e-24 Plant protein 1589 of unknown function (A_thal_3526)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014237)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G10657 AT1G10657 AT1G10657 AT1G10657
fragaria_vesca FvH4_4g32920
malus_domestica MD13G1095000.v1.1 MD16G1096100.v1.1
prunus_persica Prupe.1G250400_v2.0.a1
pyrus_communis pycom13g08280
rosa_chinensis RchiOBHm_Chr4g0441951
rosa_multiflora Rmu_sc0002501.1_g000031 Rmu_sc0011990.1_g000009
rosa_roxburghii Rroxscaffold_5G00382780
rosa_rugosa Rorug04G0337100 Rorug04G0337200
rosa_samantha Rh4AG389100
rosa_wichuraiana Rw4G033600

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 22
AcyI GRCGYC 1 cut(s) 28
AfiI CCNNNNNNNGG 1 cut(s) 22
AgsI TTSAA 2 cut(s) 74, 215
AjnI CCWGG 2 cut(s) 21, 242
AluBI AGCT 4 cut(s) 57, 187, 272, 276
AluI AGCT 4 cut(s) 57, 187, 272, 276
AoxI GGCC 2 cut(s) 129, 245
AsuNHI GCTAGC 1 cut(s) 272
BccI CCATC 2 cut(s) 24, 61
BciT130I CCWGG 2 cut(s) 23, 244
BfaI CTAG 2 cut(s) 273, 277
BfmI CTRYAG 1 cut(s) 188
Bme1390I CCNGG 2 cut(s) 23, 244
BmrFI CCNGG 2 cut(s) 23, 244
BmsI GCATC 1 cut(s) 13
BmtI GCTAGC 1 cut(s) 276
Bpu10I CCTNAGC 1 cut(s) 133
BsaHI GRCGYC 1 cut(s) 28
BsaJI CCNNGG 1 cut(s) 22
Bsc4I CCNNNNNNNGG 1 cut(s) 22
Bse3DI GCAATG 1 cut(s) 40
BseBI CCWGG 2 cut(s) 23, 244
BseDI CCNNGG 1 cut(s) 22
BseGI GGATG 1 cut(s) 72
BseLI CCNNNNNNNGG 1 cut(s) 22
BseMI GCAATG 1 cut(s) 40
BshFI GGCC 2 cut(s) 131, 247
BslI CCNNNNNNNGG 1 cut(s) 22
BsnI GGCC 2 cut(s) 131, 247
BspANI GGCC 2 cut(s) 131, 247
BspOI GCTAGC 1 cut(s) 276
BsrDI GCAATG 1 cut(s) 40
BssECI CCNNGG 1 cut(s) 22
BssNI GRCGYC 1 cut(s) 28
Bst2UI CCWGG 2 cut(s) 23, 244
Bst4CI ACNGT 1 cut(s) 175
BstACI GRCGYC 1 cut(s) 28
BstAPI GCANNNNNTGC 1 cut(s) 143
BstC8I GCNNGC 3 cut(s) 38, 144, 274
BstDEI CTNAG 1 cut(s) 133
BstF5I GGATG 1 cut(s) 72
BstMWI GCNNNNNNNGC 2 cut(s) 42, 143
BstNI CCWGG 2 cut(s) 23, 244
BstNSI RCATGY 1 cut(s) 146
BstSCI CCNGG 2 cut(s) 21, 242
BstSFI CTRYAG 1 cut(s) 188
BsuRI GGCC 2 cut(s) 131, 247
BtsCI GGATG 1 cut(s) 72
BtsIMutI CAGTG 1 cut(s) 180
Cac8I GCNNGC 3 cut(s) 38, 144, 274
CseI GACGC 1 cut(s) 17
CviAII CATG 3 cut(s) 33, 106, 143
CviJI RGCY 6 cut(s) 57, 131, 187, 247, 272, 276
CviKI_1 RGCY 6 cut(s) 57, 131, 187, 247, 272, 276
DdeI CTNAG 1 cut(s) 133
Eco147I AGGCCT 2 cut(s) 131, 247
EcoRII CCWGG 2 cut(s) 21, 242
EcoT22I ATGCAT 2 cut(s) 6, 125
FaeI CATG 3 cut(s) 36, 109, 146
FaiI YATR 7 cut(s) 12, 34, 107, 125, 144, 220, 269
FatI CATG 3 cut(s) 32, 105, 142
FokI GGATG 1 cut(s) 79
FspBI CTAG 2 cut(s) 273, 277
HaeIII GGCC 2 cut(s) 131, 247
HgaI GACGC 1 cut(s) 17
Hin1I GRCGYC 1 cut(s) 28
Hin1II CATG 3 cut(s) 36, 109, 146
HinfI GANTC 1 cut(s) 109
Hpy188III TCNNGA 1 cut(s) 113
HpyAV CCTTC 1 cut(s) 274
HpyCH4III ACNGT 1 cut(s) 175
HpyCH4V TGCA 4 cut(s) 4, 40, 123, 146
HpyF10VI GCNNNNNNNGC 2 cut(s) 42, 143
HpyF3I CTNAG 1 cut(s) 133
Hsp92I GRCGYC 1 cut(s) 28
Hsp92II CATG 3 cut(s) 36, 109, 146
LpnPI CCDG 4 cut(s) 8, 35, 229, 256
LweI GCATC 1 cut(s) 13
MaeI CTAG 2 cut(s) 273, 277
MaeIII GTNAC 1 cut(s) 113
MlyI GAGTC 1 cut(s) 118
Mph1103I ATGCAT 2 cut(s) 6, 125
MseI TTAA 1 cut(s) 251
MslI CAYNNNNRTG 1 cut(s) 65
MspR9I CCNGG 2 cut(s) 23, 244
MvaI CCWGG 2 cut(s) 23, 244
MwoI GCNNNNNNNGC 2 cut(s) 42, 143
NheI GCTAGC 1 cut(s) 272
NlaIII CATG 3 cut(s) 36, 109, 146
NmuCI GTSAC 1 cut(s) 113
NsiI ATGCAT 2 cut(s) 6, 125
NspI RCATGY 1 cut(s) 146
PaeI GCATGC 1 cut(s) 146
PceI AGGCCT 2 cut(s) 131, 247
PflMI CCANNNNNTGG 1 cut(s) 22
PleI GAGTC 1 cut(s) 117
PpsI GAGTC 1 cut(s) 117
Psp6I CCWGG 2 cut(s) 21, 242
PspGI CCWGG 2 cut(s) 21, 242
RseI CAYNNNNRTG 1 cut(s) 65
SaqAI TTAA 1 cut(s) 251
SchI GAGTC 1 cut(s) 118
ScrFI CCNGG 2 cut(s) 23, 244
SetI ASST 5 cut(s) 59, 189, 266, 274, 278
SfaNI GCATC 1 cut(s) 13
SfcI CTRYAG 1 cut(s) 188
SmiMI CAYNNNNRTG 1 cut(s) 65
SphI GCATGC 1 cut(s) 146
SseBI AGGCCT 2 cut(s) 131, 247
SspI AATATT 1 cut(s) 151
SspMI CTAG 2 cut(s) 273, 277
StuI AGGCCT 2 cut(s) 131, 247
StyD4I CCNGG 2 cut(s) 21, 242
TaaI ACNGT 1 cut(s) 175
Tru1I TTAA 1 cut(s) 251
Tru9I TTAA 1 cut(s) 251
TscAI CASTG 1 cut(s) 180
TseFI GTSAC 1 cut(s) 113
Tsp45I GTSAC 1 cut(s) 113
TspDTI ATGAA 1 cut(s) 256
TspRI CASTG 1 cut(s) 180
Van91I CCANNNNNTGG 1 cut(s) 22
XceI RCATGY 1 cut(s) 146
XspI CTAG 2 cut(s) 273, 277
Zsp2I ATGCAT 2 cut(s) 6, 125
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.