FvH4_6g15550

DNA-binding protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb6
OG0014464
Physical Location & Seq
Reverse (-)
9668345 .. 9670858
2514 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_6g15550.t1

Sequence Viewer

Length: 228 bp
ATGGCGGACGAGGTCCCTCCCTTTGACGACGTGGGGACAAAAGGATTCAACCCTGGACTGATTGTGTTGCTTGTTGTTGTTGGGTTGCTGGTGATTTTTCTGGTTGGAAACTATGCACTTTATGTTTATGCTCAGAGAACTATTCCTCCAAAAAAGAAGAAGCCAGTGTCCAAGAAGAAGCTGAAGAAGGAGAGGCTGAAGCAAGGTGTCTCTGCCCCAGGGGAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
S1FA

Protein Analysis

76

Amino Acids

8.21

Weight (kDa)

9.87

Isoelectric Point (pI)

21.8

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
S1FA PF04689 12 - 75 1.8e-37 DNA binding protein S1FA
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014464)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G37120 AT3G09735 AT3G53370 AT3G53370
fragaria_vesca FvH4_6g15550
malus_domestica MD04G1102100.v1.1 MD12G1121800.v1.1
prunus_persica Prupe.6G239600_v2.0.a1
pyrus_communis pycom04g09740 pycom12g12090
rosa_chinensis RchiOBHm_Chr3g0469111
rosa_multiflora Rmu_sc0000302.1_g000015 Rmu_sc0007933.1_g000019
rosa_roxburghii Rroxscaffold_6G00412200
rosa_rugosa Rorug03G0099800
rosa_samantha Rh3AG148800
rosa_wichuraiana Rw3G014040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 5
AcuI CTGAAG 2 cut(s) 203, 218
AgsI TTSAA 1 cut(s) 49
AjiI CACGTC 1 cut(s) 31
AjnI CCWGG 2 cut(s) 52, 217
AloI GAACNNNNNNTCC 2 cut(s) 130, 162
AluBI AGCT 1 cut(s) 181
AluI AGCT 1 cut(s) 181
Alw26I GTCTC 1 cut(s) 214
AspS9I GGNCC 1 cut(s) 13
AsuHPI GGTGA 1 cut(s) 103
AvaII GGWCC 1 cut(s) 13
BciT130I CCWGG 2 cut(s) 54, 219
BcoDI GTCTC 1 cut(s) 214
Bme1390I CCNGG 2 cut(s) 54, 219
Bme18I GGWCC 1 cut(s) 13
BmgBI CACGTC 1 cut(s) 31
BmgT120I GGNCC 1 cut(s) 13
BmiI GGNNCC 1 cut(s) 15
BmrFI CCNGG 2 cut(s) 54, 219
BsaJI CCNNGG 3 cut(s) 52, 217, 218
BsaXI ACNNNNNCTCC 2 cut(s) 130, 160
Bse1I ACTGG 1 cut(s) 164
BseBI CCWGG 2 cut(s) 54, 219
BseDI CCNNGG 3 cut(s) 52, 217, 218
BseMII CTCAG 1 cut(s) 146
BseNI ACTGG 1 cut(s) 164
BslFI GGGAC 1 cut(s) 49
BsmAI GTCTC 1 cut(s) 214
BsmFI GGGAC 1 cut(s) 49
BspACI CCGC 1 cut(s) 5
BspCNI CTCAG 1 cut(s) 145
BspLI GGNNCC 1 cut(s) 15
BsrI ACTGG 1 cut(s) 164
BssECI CCNNGG 3 cut(s) 52, 217, 218
Bst2UI CCWGG 2 cut(s) 54, 219
BstDEI CTNAG 1 cut(s) 132
BstMAI GTCTC 1 cut(s) 214
BstNI CCWGG 2 cut(s) 54, 219
BstSCI CCNGG 2 cut(s) 52, 217
BtrI CACGTC 1 cut(s) 31
BtsIMutI CAGTG 1 cut(s) 171
Cfr13I GGNCC 1 cut(s) 13
CviJI RGCY 3 cut(s) 163, 181, 196
CviKI_1 RGCY 3 cut(s) 163, 181, 196
DdeI CTNAG 1 cut(s) 132
EciI GGCGGA 1 cut(s) 20
Eco47I GGWCC 1 cut(s) 13
Eco57I CTGAAG 2 cut(s) 203, 218
EcoO109I RGGNCCY 1 cut(s) 13
EcoRII CCWGG 2 cut(s) 52, 217
FaiI YATR 3 cut(s) 114, 123, 129
FaqI GGGAC 1 cut(s) 49
HinfI GANTC 1 cut(s) 45
HphI GGTGA 1 cut(s) 103
Hpy188I TCNGA 1 cut(s) 135
Hpy99I CGWCG 1 cut(s) 32
HpyAV CCTTC 1 cut(s) 181
HpyCH4IV ACGT 1 cut(s) 30
HpyCH4V TGCA 1 cut(s) 116
HpyF3I CTNAG 1 cut(s) 132
HpySE526I ACGT 1 cut(s) 30
LpnPI CCDG 6 cut(s) 39, 66, 74, 86, 177, 204
MaeII ACGT 1 cut(s) 30
MboII GAAGA 3 cut(s) 169, 187, 196
MmeI TCCRAC 1 cut(s) 85
MnlI CCTC 4 cut(s) 4, 27, 156, 186
MspR9I CCNGG 2 cut(s) 54, 219
MvaI CCWGG 2 cut(s) 54, 219
NlaIV GGNNCC 1 cut(s) 15
PasI CCCWGGG 1 cut(s) 218
PfeI GAWTC 1 cut(s) 45
PflFI GACNNNGTC 1 cut(s) 11
PpuMI RGGWCCY 1 cut(s) 13
Psp5II RGGWCCY 1 cut(s) 13
Psp6I CCWGG 2 cut(s) 52, 217
PspGI CCWGG 2 cut(s) 52, 217
PspN4I GGNNCC 1 cut(s) 15
PspPI GGNCC 1 cut(s) 13
PspPPI RGGWCCY 1 cut(s) 13
PsyI GACNNNGTC 1 cut(s) 11
Sau96I GGNCC 1 cut(s) 13
ScrFI CCNGG 2 cut(s) 54, 219
SetI ASST 4 cut(s) 15, 33, 183, 208
SinI GGWCC 1 cut(s) 13
SsiI CCGC 1 cut(s) 5
StyD4I CCNGG 2 cut(s) 52, 217
TaiI ACGT 1 cut(s) 33
TfiI GAWTC 1 cut(s) 45
TscAI CASTG 1 cut(s) 171
TspRI CASTG 1 cut(s) 171
Tth111I GACNNNGTC 1 cut(s) 11
VpaK11BI GGWCC 1 cut(s) 13
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.