Basic Information

Type: gene

Biological Identity

Species

fragaria_vesca

Chromosome

Fvb6

Orthogroup ID

OG0017691

Physical Location & Seq

Genomic Coordinates Forward (+)

11980040 .. 11980768

Gene Structure 729 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

FvH4_6g18163.t1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 600 bp

ATGTGGCTTAATCATGAGAAGTTCCTGGATATGGTCTCTGAGCAGTGGAATAGCTACCATGGTGATTTATTGGTTAAGACTAGTAGATTAGCTAGTACTCTTGTTGATTGGAATAAGAATGTTTTTGGTAATATTTTTAAGCAAAAGAGGATCCTTAGTGCAAGAATTTGTGGTATTCAGCGAAGCTTGGGAAGAGGTCCAAATCAATTCTTACAGGATCTTGAAAAGCAGTTGATTTCTGATTATGAAAAAATTAGAGAAGCTGAGGCTCTTTTTTGGAAACAGAAGTCAAGAGATAATTGGCTTTGTGAGGGTGATCGCAATACCAAGTTTTTTCATCTCACCACTATTGACTTAAGGACAATTATTCCTTCTCTCTTTCCTGATGTCTCTAATGATGAGATGTTTTATTTGAATAGACCTATTTCTGAACAGGACATTCATGATACTCTCTCTAGAATTGGGAAGTTGAAAGCTCCTGGTGTTGATGGTTTTCCAGCTCTCATTTTTCAACAGCATTGGAATCTATGTGCTCTTGATATTATTGAAGTTGTTTCTAAAGCTTTCACCTCTGGCTCCATTCCTCCAATCATACTTTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

C2 DUF4283 RVT_1 RVT_3 zf-RVT

Protein Analysis

200

Amino Acids

23.07

Weight (kDa)

6.96

Isoelectric Point (pI)

40.61

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017691)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_6g18163
rosa_multiflora	Rmu_co8106108.1_g000001 Rmu_sc0000324.1_g000008 Rmu_sc0000367.1_g000089 Rmu_sc0000733.1_g000013 Rmu_sc0001152.1_g000050 Rmu_sc0001227.1_g000003 Rmu_sc0002194.1_g000036 Rmu_sc0002557.1_g000015 Rmu_sc0005339.1_g000007 Rmu_sc0012746.1_g000024 Rmu_sc0028686.1_g000001

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	3 cut(s)	145, 158, 225
AcsI	RAATTY	1 cut(s)	165
AfaI	GTAC	1 cut(s)	97
AfiI	CCNNNNNNNGG	1 cut(s)	31
AflII	CTTAAG	1 cut(s)	355
AgsI	TTSAA	5 cut(s)	224, 415, 472, 512, 548
AhlI	ACTAGT	1 cut(s)	80
AjnI	CCWGG	2 cut(s)	24, 478
AluBI	AGCT	7 cut(s)	54, 92, 186, 263, 476, 500, 563
AluI	AGCT	7 cut(s)	54, 92, 186, 263, 476, 500, 563
Alw21I	GWGCWC	1 cut(s)	535
Alw26I	GTCTC	2 cut(s)	40, 394
AlwI	GGATC	3 cut(s)	145, 158, 225
ApoI	RAATTY	1 cut(s)	165
AspS9I	GGNCC	1 cut(s)	197
AsuHPI	GGTGA	4 cut(s)	74, 326, 334, 559
AvaII	GGWCC	1 cut(s)	197
BamHI	GGATCC	1 cut(s)	150
Bbv12I	GWGCWC	1 cut(s)	535
BbvCI	CCTCAGC	1 cut(s)	264
BccI	CCATC	1 cut(s)	482
BciT130I	CCWGG	2 cut(s)	26, 480
BcoDI	GTCTC	2 cut(s)	40, 394
BcuI	ACTAGT	1 cut(s)	80
BfaI	CTAG	3 cut(s)	81, 93, 456
BfrI	CTTAAG	1 cut(s)	355
BmcAI	AGTACT	1 cut(s)	97
Bme1390I	CCNGG	2 cut(s)	26, 480
Bme18I	GGWCC	1 cut(s)	197
BmgT120I	GGNCC	1 cut(s)	197
BmiI	GGNNCC	2 cut(s)	152, 577
BmrFI	CCNGG	2 cut(s)	26, 480
Bpu10I	CCTNAGC	1 cut(s)	264
BsaI	GGTCTC	1 cut(s)	40
BsaJI	CCNNGG	1 cut(s)	58
Bsc4I	CCNNNNNNNGG	1 cut(s)	31
BseBI	CCWGG	2 cut(s)	26, 480
BseDI	CCNNGG	1 cut(s)	58
BseLI	CCNNNNNNNGG	1 cut(s)	31
BseMII	CTCAG	2 cut(s)	30, 255
BsiHKAI	GWGCWC	1 cut(s)	535
BslI	CCNNNNNNNGG	1 cut(s)	31
BsmAI	GTCTC	2 cut(s)	40, 394
Bso31I	GGTCTC	1 cut(s)	40
Bsp1286I	GDGCHC	1 cut(s)	535
Bsp143I	GATC	3 cut(s)	150, 217, 316
Bsp19I	CCATGG	1 cut(s)	58
BspCNI	CTCAG	2 cut(s)	31, 256
BspHI	TCATGA	2 cut(s)	13, 442
BspLI	GGNNCC	2 cut(s)	152, 577
BspPI	GGATC	3 cut(s)	145, 158, 225
BspTI	CTTAAG	1 cut(s)	355
BspTNI	GGTCTC	1 cut(s)	40
BssECI	CCNNGG	1 cut(s)	58
BssMI	GATC	3 cut(s)	150, 217, 316
BssT1I	CCWWGG	1 cut(s)	58
Bst2UI	CCWGG	2 cut(s)	26, 480
Bst6I	CTCTTC	1 cut(s)	187
BstAFI	CTTAAG	1 cut(s)	355
BstDEI	CTNAG	3 cut(s)	39, 155, 264
BstDSI	CCRYGG	1 cut(s)	58
BstKTI	GATC	3 cut(s)	153, 220, 319
BstMAI	GTCTC	2 cut(s)	40, 394
BstMBI	GATC	3 cut(s)	150, 217, 316
BstNI	CCWGG	2 cut(s)	26, 480
BstSCI	CCNGG	2 cut(s)	24, 478
BstX2I	RGATCY	2 cut(s)	150, 217
BstYI	RGATCY	2 cut(s)	150, 217
BtgI	CCRYGG	1 cut(s)	58
BtsI	GCAGTG	1 cut(s)	50
BtsIMutI	CAGTG	1 cut(s)	50
CciI	TCATGA	2 cut(s)	13, 442
Cfr13I	GGNCC	1 cut(s)	197
Csp6I	GTAC	1 cut(s)	96
CviAII	CATG	3 cut(s)	14, 59, 443
CviQI	GTAC	1 cut(s)	96
DdeI	CTNAG	3 cut(s)	39, 155, 264
DpnI	GATC	3 cut(s)	152, 219, 318
DpnII	GATC	3 cut(s)	150, 217, 316
Eam1104I	CTCTTC	1 cut(s)	187
EarI	CTCTTC	1 cut(s)	187
Eco130I	CCWWGG	1 cut(s)	58
Eco31I	GGTCTC	1 cut(s)	40
Eco47I	GGWCC	1 cut(s)	197
EcoRII	CCWGG	2 cut(s)	24, 478
EcoT14I	CCWWGG	1 cut(s)	58
ErhI	CCWWGG	1 cut(s)	58
FaeI	CATG	3 cut(s)	17, 62, 446
FaiI	YATR	7 cut(s)	15, 32, 60, 246, 444, 529, 593
FatI	CATG	3 cut(s)	13, 58, 442
FspBI	CTAG	3 cut(s)	81, 93, 456
Hin1II	CATG	3 cut(s)	17, 62, 446
HindIII	AAGCTT	2 cut(s)	184, 561
HinfI	GANTC	1 cut(s)	523
HphI	GGTGA	4 cut(s)	74, 326, 334, 559
Hpy188I	TCNGA	3 cut(s)	40, 241, 430
Hpy188III	TCNNGA	7 cut(s)	14, 221, 291, 383, 443, 456, 536
HpyAV	CCTTC	1 cut(s)	381
HpyCH4V	TGCA	1 cut(s)	161
HpyF3I	CTNAG	3 cut(s)	39, 155, 264
Hsp92II	CATG	3 cut(s)	17, 62, 446
Kzo9I	GATC	3 cut(s)	150, 217, 316
LmnI	GCTCC	2 cut(s)	481, 581
LpnPI	CCDG	9 cut(s)	11, 38, 200, 396, 419, 465, 492, 510, 558
MaeI	CTAG	3 cut(s)	81, 93, 456
MalI	GATC	3 cut(s)	152, 219, 318
MboI	GATC	3 cut(s)	150, 217, 316
MboII	GAAGA	1 cut(s)	204
MflI	RGATCY	2 cut(s)	150, 217
MhlI	GDGCHC	1 cut(s)	535
MluCI	AATT	6 cut(s)	165, 206, 252, 298, 363, 459
MnlI	CCTC	6 cut(s)	141, 188, 259, 304, 580, 594
MseI	TTAA	4 cut(s)	9, 75, 138, 356
MspCI	CTTAAG	1 cut(s)	355
MspR9I	CCNGG	2 cut(s)	26, 480
MvaI	CCWGG	2 cut(s)	26, 480
NcoI	CCATGG	1 cut(s)	58
NdeII	GATC	3 cut(s)	150, 217, 316
NlaIII	CATG	3 cut(s)	17, 62, 446
NlaIV	GGNNCC	2 cut(s)	152, 577
PagI	TCATGA	2 cut(s)	13, 442
PfeI	GAWTC	1 cut(s)	523
PfoI	TCCNGGA	1 cut(s)	24
Psp6I	CCWGG	2 cut(s)	24, 478
PspGI	CCWGG	2 cut(s)	24, 478
PspN4I	GGNNCC	2 cut(s)	152, 577
PspPI	GGNCC	1 cut(s)	197
PsuI	RGATCY	2 cut(s)	150, 217
RsaI	GTAC	1 cut(s)	97
RsaNI	GTAC	1 cut(s)	96
SaqAI	TTAA	4 cut(s)	9, 75, 138, 356
Sau3AI	GATC	3 cut(s)	150, 217, 316
Sau96I	GGNCC	1 cut(s)	197
ScaI	AGTACT	1 cut(s)	97
ScrFI	CCNGG	2 cut(s)	26, 480
SduI	GDGCHC	1 cut(s)	535
SinI	GGWCC	1 cut(s)	197
SmlI	CTYRAG	1 cut(s)	355
SmoI	CTYRAG	1 cut(s)	355
SpeI	ACTAGT	1 cut(s)	80
Sse9I	AATT	6 cut(s)	165, 206, 252, 298, 363, 459
SspI	AATATT	1 cut(s)	133
SspMI	CTAG	3 cut(s)	81, 93, 456
StyD4I	CCNGG	2 cut(s)	24, 478
StyI	CCWWGG	1 cut(s)	58
TasI	AATT	6 cut(s)	165, 206, 252, 298, 363, 459
TatI	WGTACW	1 cut(s)	95
TfiI	GAWTC	1 cut(s)	523
Tru1I	TTAA	4 cut(s)	9, 75, 138, 356
Tru9I	TTAA	4 cut(s)	9, 75, 138, 356
TscAI	CASTG	1 cut(s)	50
TspDTI	ATGAA	3 cut(s)	261, 326, 431
TspRI	CASTG	1 cut(s)	50
Vha464I	CTTAAG	1 cut(s)	355
VpaK11BI	GGWCC	1 cut(s)	197
XapI	RAATTY	1 cut(s)	165
XbaI	TCTAGA	1 cut(s)	455
XspI	CTAG	3 cut(s)	81, 93, 456
ZrmI	AGTACT	1 cut(s)	97

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.