Rmu_sc0002557.1_g000015

acid phosphatase activity

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002557.1
OG0017691
Physical Location & Seq
Reverse (-)
78793 .. 79326
534 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002557.1_g000015.1.cds

Sequence Viewer

Length: 534 bp
atggtccgcagaaggaaaaacagaattgaggctctacttgacaatgatggagttttattcagtgacataaatggtatgaaatctattgcagttgagttttttgcgaatttattttcttataattctgttgaagatgtgagattcattattccttatctatttcctactctggatagttatgatttgagaaagatgagtagatgcatttctagggatgaggtaaaaaatgttgtgttcaatattgggtgcttgaaatctcctggtgctggatttcctgctcttttctatcatcgccattgcgatatccttgctgaggaaatttttcagttggttaattctgctatgcattctggccaaattcctgatggtcttaaccacactctaattactcttgttcccaaagtggctagtcctcaaagtttggctctcttccgacccattagcctttgtaatactctctataaagttacatccaaagtgttggttgctcgaattagacctcttcttaagtatcttattgttgtgaaattttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
C2 DUF4283 RVT_1 RVT_3 zf-RVT

Protein Analysis

177

Amino Acids

20.11

Weight (kDa)

9.39

Isoelectric Point (pI)

53.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 120
AciI CCGC 1 cut(s) 7
AcoI YGGCCR 1 cut(s) 352
AcsI RAATTY 4 cut(s) 106, 318, 357, 527
AfiI CCNNNNNNNGG 2 cut(s) 266, 313
AflII CTTAAG 1 cut(s) 506
AgsI TTSAA 3 cut(s) 131, 238, 253
AjnI CCWGG 1 cut(s) 259
AoxI GGCC 1 cut(s) 352
ApoI RAATTY 4 cut(s) 106, 318, 357, 527
Asp700I GAANNNNTTC 1 cut(s) 321
AspS9I GGNCC 1 cut(s) 4
AvaII GGWCC 1 cut(s) 4
BalI TGGCCA 1 cut(s) 354
BbvCI CCTCAGC 1 cut(s) 312
BccI CCATC 2 cut(s) 41, 359
BcgI CGANNNNNNTGC 2 cut(s) 290, 324
BciT130I CCWGG 1 cut(s) 261
BfaI CTAG 2 cut(s) 210, 408
BfrI CTTAAG 1 cut(s) 506
Bme1390I CCNGG 1 cut(s) 261
Bme18I GGWCC 1 cut(s) 4
BmgT120I GGNCC 1 cut(s) 4
BmrFI CCNGG 1 cut(s) 261
BmsI GCATC 1 cut(s) 191
Bpu10I CCTNAGC 1 cut(s) 312
Bsc4I CCNNNNNNNGG 2 cut(s) 266, 313
Bse3DI GCAATG 1 cut(s) 295
BseBI CCWGG 1 cut(s) 261
BseGI GGATG 2 cut(s) 220, 470
BseLI CCNNNNNNNGG 2 cut(s) 266, 313
BseMI GCAATG 1 cut(s) 295
BseMII CTCAG 1 cut(s) 303
BshFI GGCC 1 cut(s) 354
BslI CCNNNNNNNGG 2 cut(s) 266, 313
BsmI GAATGC 1 cut(s) 346
BsnI GGCC 1 cut(s) 354
BspACI CCGC 1 cut(s) 7
BspANI GGCC 1 cut(s) 354
BspCNI CTCAG 1 cut(s) 304
BspTI CTTAAG 1 cut(s) 506
BsrDI GCAATG 1 cut(s) 295
Bst2UI CCWGG 1 cut(s) 261
Bst6I CTCTTC 2 cut(s) 434, 507
BstAFI CTTAAG 1 cut(s) 506
BstDEI CTNAG 1 cut(s) 312
BstENI CCTNNNNNAGG 1 cut(s) 311
BstF5I GGATG 2 cut(s) 220, 470
BstNI CCWGG 1 cut(s) 261
BstSCI CCNGG 1 cut(s) 259
BstXI CCANNNNNNTGG 1 cut(s) 481
BsuRI GGCC 1 cut(s) 354
BtgZI GCGATG 1 cut(s) 275
BtsCI GGATG 2 cut(s) 220, 470
BtsIMutI CAGTG 1 cut(s) 67
Cfr13I GGNCC 1 cut(s) 4
CviJI RGCY 5 cut(s) 32, 354, 407, 425, 444
CviKI_1 RGCY 5 cut(s) 32, 354, 407, 425, 444
DdeI CTNAG 1 cut(s) 312
EaeI YGGCCR 1 cut(s) 352
Eam1104I CTCTTC 2 cut(s) 434, 507
EarI CTCTTC 2 cut(s) 434, 507
Eco32I GATATC 1 cut(s) 304
Eco47I GGWCC 1 cut(s) 4
EcoNI CCTNNNNNAGG 1 cut(s) 311
EcoRII CCWGG 1 cut(s) 259
EcoRV GATATC 1 cut(s) 304
EcoT22I ATGCAT 2 cut(s) 206, 348
FaiI YATR 6 cut(s) 68, 77, 120, 180, 344, 462
FokI GGATG 2 cut(s) 227, 457
FspBI CTAG 2 cut(s) 210, 408
HaeIII GGCC 1 cut(s) 354
HinfI GANTC 1 cut(s) 141
Hpy188I TCNGA 1 cut(s) 434
Hpy188III TCNNGA 2 cut(s) 170, 362
HpyAV CCTTC 1 cut(s) 6
HpyCH4V TGCA 3 cut(s) 89, 204, 346
HpyF3I CTNAG 1 cut(s) 312
LpnPI CCDG 7 cut(s) 155, 246, 252, 273, 288, 336, 375
LweI GCATC 1 cut(s) 191
MaeI CTAG 2 cut(s) 210, 408
MaeIII GTNAC 2 cut(s) 62, 466
MboII GAAGA 3 cut(s) 143, 421, 494
MlsI TGGCCA 1 cut(s) 354
MluCI AATT 9 cut(s) 24, 106, 121, 318, 334, 357, 384, 492, 527
MluNI TGGCCA 1 cut(s) 354
MmeI TCCRAC 1 cut(s) 457
MnlI CCTC 5 cut(s) 22, 211, 307, 423, 510
Mox20I TGGCCA 1 cut(s) 354
Mph1103I ATGCAT 2 cut(s) 206, 348
MroXI GAANNNNTTC 1 cut(s) 321
MscI TGGCCA 1 cut(s) 354
MseI TTAA 4 cut(s) 333, 372, 507, 532
Msp20I TGGCCA 1 cut(s) 354
MspCI CTTAAG 1 cut(s) 506
MspR9I CCNGG 1 cut(s) 261
Mva1269I GAATGC 1 cut(s) 346
MvaI CCWGG 1 cut(s) 261
NmuCI GTSAC 1 cut(s) 62
NsiI ATGCAT 2 cut(s) 206, 348
PctI GAATGC 1 cut(s) 346
PdmI GAANNNNTTC 1 cut(s) 321
PfeI GAWTC 1 cut(s) 141
PsiI TTATAA 1 cut(s) 120
Psp6I CCWGG 1 cut(s) 259
PspGI CCWGG 1 cut(s) 259
PspPI GGNCC 1 cut(s) 4
SaqAI TTAA 4 cut(s) 333, 372, 507, 532
Sau96I GGNCC 1 cut(s) 4
ScrFI CCNGG 1 cut(s) 261
SetI ASST 2 cut(s) 222, 502
SfaNI GCATC 1 cut(s) 191
SinI GGWCC 1 cut(s) 4
SmlI CTYRAG 1 cut(s) 506
SmoI CTYRAG 1 cut(s) 506
Sse9I AATT 9 cut(s) 24, 106, 121, 318, 334, 357, 384, 492, 527
SsiI CCGC 1 cut(s) 7
SspI AATATT 1 cut(s) 241
SspMI CTAG 2 cut(s) 210, 408
StyD4I CCNGG 1 cut(s) 259
TaqI TCGA 1 cut(s) 490
TasI AATT 9 cut(s) 24, 106, 121, 318, 334, 357, 384, 492, 527
TfiI GAWTC 1 cut(s) 141
Tru1I TTAA 4 cut(s) 333, 372, 507, 532
Tru9I TTAA 4 cut(s) 333, 372, 507, 532
TscAI CASTG 1 cut(s) 67
TseFI GTSAC 1 cut(s) 62
Tsp45I GTSAC 1 cut(s) 62
TspDTI ATGAA 2 cut(s) 92, 133
TspRI CASTG 1 cut(s) 67
Vha464I CTTAAG 1 cut(s) 506
VpaK11BI GGWCC 1 cut(s) 4
XagI CCTNNNNNAGG 1 cut(s) 311
XapI RAATTY 4 cut(s) 106, 318, 357, 527
XcmI CCANNNNNNNNNTGG 1 cut(s) 362
XmnI GAANNNNTTC 1 cut(s) 321
XspI CTAG 2 cut(s) 210, 408
Zsp2I ATGCAT 2 cut(s) 206, 348
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.